EMAIL THIS PAGE TO A FRIEND

PTH2

parathyroid hormone 2

36 Gene Product Result for
Synonyms: TIP39
UniProtKB ID: Q96A98, Q96DJ4
Gene ID:
Human(113091) Summary: TIP39 is related to parathyroid hormone (PTH; MIM 168450) and PTH-related protein (PTHRP; MIM 168470) and is a ligand for PTH receptor-2 (PTHR2; MIM 601469) (John et al., 2002 [PubMed 11861531]
Mouse(114640) parathyroid hormone 2
Rat(499149) parathyroid hormone 2
Zebrafish(402812) parathyroid hormone 2
dog(611953) parathyroid hormone 2
domestic cat(101097688) parathyroid hormone 2
domestic guinea pig(100724546) parathyroid hormone 2
naked mole-rat(101701704) parathyroid hormone 2
cow(617680) parathyroid hormone 2
sheep(101111118) parathyroid hormone 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV53357 Anti-PTH2 antibody produced in rabbit affinity isolated antibody human, bovine, horse, guinea pig, rat, dog, mouse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053256 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053256 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053256 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178449 Rosetta Predictions human pricing
NM_001109144 Rosetta Predictions rat pricing
NM_053256 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178449 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213087 predicted 344
2 SASI_Hs01_00213088 predicted 379
3 SASI_Hs01_00213089 predicted 357
4 SASI_Hs01_00213090 predicted 178
5 SASI_Hs01_00213091 predicted 357
6 SASI_Hs01_00213092 predicted 345
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109144 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245560 predicted 244
2 SASI_Rn02_00245561 predicted 250
3 SASI_Rn02_00245562 predicted 253
4 SASI_Rn02_00245563 predicted 200
5 SASI_Rn02_00245564 predicted 249
6 SASI_Rn02_00245565 predicted 396
7 SASI_Rn02_00245566 predicted 401
8 SASI_Rn02_00245567 predicted 398
9 SASI_Rn02_00245568 predicted 354
10 SASI_Rn02_00245569 predicted 193
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053256 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131789 predicted 258
2 SASI_Mm01_00131790 predicted 398
3 SASI_Mm01_00131791 predicted 402
4 SASI_Mm01_00131792 predicted 403
5 SASI_Mm01_00131793 predicted 357
6 SASI_Mm01_00131794 predicted 436
7 SASI_Mm01_00131795 predicted 398
8 SASI_Mm01_00131796 predicted 440
9 SASI_Mm01_00131797 predicted 397
10 SASI_Mm01_00131798 predicted 432
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053256
PTH2 MISSION shRNA Bacterial Glycerol Stock
parathyroid hormone 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053256.1-223s1c1
Sequence:CCGGCCTCGCTGGTGTGTTCAGCCTCTCGAGAGGCTGAACACACCAGCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053256.1-143s1c1
Sequence:CCGGCGAGAGCGGCTGTTGCTGCTTCTCGAGAAGCAGCAACAGCCGCTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053256.1-144s1c1
Sequence:CCGGGAGAGCGGCTGTTGCTGCTTTCTCGAGAAAGCAGCAACAGCCGCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053256.1-168s1c1
Sequence:CCGGTGCTGCTACTGCTTGTGCCCTCTCGAGAGGGCACAAGCAGTAGCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053256.1-199s1c1
Sequence:CCGGCCCTGCCTCAGGTGTTGCCCTCTCGAGAGGGCAACACCTGAGGCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053256
PTH2 MISSION shRNA shRNA Plasmid DNA
parathyroid hormone 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053256.1-223s1c1
Sequence:CCGGCCTCGCTGGTGTGTTCAGCCTCTCGAGAGGCTGAACACACCAGCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053256.1-143s1c1
Sequence:CCGGCGAGAGCGGCTGTTGCTGCTTCTCGAGAAGCAGCAACAGCCGCTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053256.1-144s1c1
Sequence:CCGGGAGAGCGGCTGTTGCTGCTTTCTCGAGAAAGCAGCAACAGCCGCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053256.1-168s1c1
Sequence:CCGGTGCTGCTACTGCTTGTGCCCTCTCGAGAGGGCACAAGCAGTAGCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053256.1-199s1c1
Sequence:CCGGCCCTGCCTCAGGTGTTGCCCTCTCGAGAGGGCAACACCTGAGGCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053256
PTH2 MISSION shRNA Lentiviral Transduction Particles
parathyroid hormone 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053256.1-223s1c1
Sequence:CCGGCCTCGCTGGTGTGTTCAGCCTCTCGAGAGGCTGAACACACCAGCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053256.1-143s1c1
Sequence:CCGGCGAGAGCGGCTGTTGCTGCTTCTCGAGAAGCAGCAACAGCCGCTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053256.1-144s1c1
Sequence:CCGGGAGAGCGGCTGTTGCTGCTTTCTCGAGAAAGCAGCAACAGCCGCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053256.1-168s1c1
Sequence:CCGGTGCTGCTACTGCTTGTGCCCTCTCGAGAGGGCACAAGCAGTAGCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053256.1-199s1c1
Sequence:CCGGCCCTGCCTCAGGTGTTGCCCTCTCGAGAGGGCAACACCTGAGGCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)