EMAIL THIS PAGE TO A FRIEND

PTH

parathyroid hormone

68 Gene Product Result for
Synonyms: PTH1
UniProtKB ID: P01270, Q4VB48, Q9UD38
Gene ID:
Human(5741) Summary: The protein encoded by this gene is a hormone secreted by parathyroid cells. This hormone elevates blood Ca2+ level by dissolving the salts in bone and preventing their renal excretion. Defects in this gene are a cause of familial isolated hypoparathyroidism (FIH). [provided by RefSeq, Jul 2008]
Mouse(19226) parathyroid hormone
Rat(24694) parathyroid hormone
chicken(396436) parathyroid hormone
domestic cat(493684) parathyroid hormone
Horse(100034104) parathyroid hormone
dog(403986) parathyroid hormone
domestic guinea pig(100713626) parathyroid hormone
naked mole-rat(101721132) parathyroid hormone
cow(280903) parathyroid hormone
sheep(101120013) parathyroid hormone
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4502489 Anti-Parathyroid Hormone antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing
SAB5500159 Anti-Parathyroid Hormone antibody, Rabbit monoclonal clone SP151, recombinant, expressed in proprietary host, affinity isolated antibody human (tested)
immunohistochemistry pricing
SAB1401320 Anti-PTH antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA048540 Anti-PTH antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody Antibody Enhanced Validation human
immunohistochemistry pricing
WH0005741M5 Monoclonal Anti-PTH antibody produced in mouse clone 4A2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunoprecipitation (IP) pricing
SAB1409555 Monoclonal Anti-PTH antibody produced in mouse clone 1E1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunoprecipitation (IP) pricing
SAB1409556 Monoclonal Anti-PTH antibody produced in mouse clone 4D7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunoprecipitation (IP) pricing
SAB1409557 Monoclonal Anti-PTH antibody produced in mouse clone 4E10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunoprecipitation (IP) pricing
SAB1409558 Monoclonal Anti-PTH antibody produced in mouse clone 4C12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunoprecipitation (IP) pricing
SAB1409562 Monoclonal Anti-PTH antibody produced in mouse clone 3E7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409563 Monoclonal Anti-PTH antibody produced in mouse clone 3C5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409564 Monoclonal Anti-PTH antibody produced in mouse clone 3H7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409565 Monoclonal Anti-PTH antibody produced in mouse clone 3C2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409566 Monoclonal Anti-PTH antibody produced in mouse clone 3D10, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404274 Monoclonal Anti-PTH, (C-terminal) antibody produced in mouse clone 2E4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunoprecipitation (IP) pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000315 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000315 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000315 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020623 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020623 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020623 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU036721 MISSION® esiRNA esiRNA human PTH (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000315 Rosetta Predictions human pricing
NM_017044 Rosetta Predictions rat pricing
NM_020623 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000315 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00302313 predicted 582
2 SASI_Hs02_00302314 predicted 519
3 SASI_Hs01_00042645 predicted 549
4 SASI_Hs01_00042646 predicted 263
5 SASI_Hs02_00302315 predicted 411
6 SASI_Hs01_00042647 predicted 567
7 SASI_Hs01_00042650 predicted 210
8 SASI_Hs01_00042651 predicted 479
9 SASI_Hs02_00302316 predicted 278
10 SASI_Hs02_00302317 predicted 247
11 SASI_Hs01_00042642 predicted 516
12 SASI_Hs01_00042643 predicted 478
13 SASI_Hs01_00042644 predicted 526
14 SASI_Hs01_00042648 predicted 420
15 SASI_Hs01_00042649 predicted 430
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017044 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00097907 predicted 428
2 SASI_Rn01_00097908 predicted 427
3 SASI_Rn01_00097909 predicted 445
4 SASI_Rn02_00261230 predicted 211
5 SASI_Rn01_00097910 predicted 286
6 SASI_Rn01_00097911 predicted 429
7 SASI_Rn01_00097912 predicted 458
8 SASI_Rn01_00097913 predicted 306
9 SASI_Rn01_00097914 predicted 447
10 SASI_Rn01_00097915 predicted 341
11 SASI_Rn01_00097916 predicted 425
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020623 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00325757 predicted 294
2 SASI_Mm02_00325758 predicted 217
3 SASI_Mm02_00325759 predicted 220
4 SASI_Mm02_00325760 predicted 208
5 SASI_Mm02_00325761 predicted 316
6 SASI_Mm02_00325762 predicted 392
7 SASI_Mm02_00325763 predicted 301
8 SASI_Mm02_00325764 predicted 191
9 SASI_Mm02_00325765 predicted 217
10 SASI_Mm02_00325766 predicted 444
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000315
PTH MISSION shRNA Bacterial Glycerol Stock
parathyroid hormone
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000315.2-416s1c1
Sequence:CCGGGCAGACAAAGCTGATGTGAATCTCGAGATTCACATCAGCTTTGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000315.2-265s1c1
Sequence:CCGGGAGAGTAGAATGGCTGCGTAACTCGAGTTACGCAGCCATTCTACTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000315.2-381s1c1
Sequence:CCGGTCTTGGTTGAGAGCCATGAAACTCGAGTTTCATGGCTCTCAACCAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000315.2-183s1c1
Sequence:CCGGCGGATGGGAAATCTGTTAAGACTCGAGTCTTAACAGATTTCCCATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373310    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000315.2-589s21c1
Sequence:CCGGTCCATCACTAGCCATGATAACCTCGAGGTTATCATGGCTAGTGATGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078028    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000315.2-509s1c1
Sequence:CCGGGCAACAATACATGCTGCTAATCTCGAGATTAGCAGCATGTATTGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000315.2-212s21c1
Sequence:CCGGGTGAGTGAAATACAGCTTATGCTCGAGCATAAGCTGTATTTCACTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000315.2-148s21c1
Sequence:CCGGGATTGTCATGTTGGCAATTTGCTCGAGCAAATTGCCAACATGACAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000315
PTH MISSION shRNA shRNA Plasmid DNA
parathyroid hormone
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000315.2-416s1c1
Sequence:CCGGGCAGACAAAGCTGATGTGAATCTCGAGATTCACATCAGCTTTGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000315.2-265s1c1
Sequence:CCGGGAGAGTAGAATGGCTGCGTAACTCGAGTTACGCAGCCATTCTACTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000315.2-381s1c1
Sequence:CCGGTCTTGGTTGAGAGCCATGAAACTCGAGTTTCATGGCTCTCAACCAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000315.2-183s1c1
Sequence:CCGGCGGATGGGAAATCTGTTAAGACTCGAGTCTTAACAGATTTCCCATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373310    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000315.2-589s21c1
Sequence:CCGGTCCATCACTAGCCATGATAACCTCGAGGTTATCATGGCTAGTGATGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078028    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000315.2-509s1c1
Sequence:CCGGGCAACAATACATGCTGCTAATCTCGAGATTAGCAGCATGTATTGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000315.2-212s21c1
Sequence:CCGGGTGAGTGAAATACAGCTTATGCTCGAGCATAAGCTGTATTTCACTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000315.2-148s21c1
Sequence:CCGGGATTGTCATGTTGGCAATTTGCTCGAGCAAATTGCCAACATGACAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000315
PTH MISSION shRNA Lentiviral Transduction Particles
parathyroid hormone
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000315.2-416s1c1
Sequence:CCGGGCAGACAAAGCTGATGTGAATCTCGAGATTCACATCAGCTTTGTCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000315.2-265s1c1
Sequence:CCGGGAGAGTAGAATGGCTGCGTAACTCGAGTTACGCAGCCATTCTACTCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000315.2-381s1c1
Sequence:CCGGTCTTGGTTGAGAGCCATGAAACTCGAGTTTCATGGCTCTCAACCAAGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000315.2-183s1c1
Sequence:CCGGCGGATGGGAAATCTGTTAAGACTCGAGTCTTAACAGATTTCCCATCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373310    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000315.2-589s21c1
Sequence:CCGGTCCATCACTAGCCATGATAACCTCGAGGTTATCATGGCTAGTGATGGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078028    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000315.2-509s1c1
Sequence:CCGGGCAACAATACATGCTGCTAATCTCGAGATTAGCAGCATGTATTGTTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000315.2-212s21c1
Sequence:CCGGGTGAGTGAAATACAGCTTATGCTCGAGCATAAGCTGTATTTCACTCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000315.2-148s21c1
Sequence:CCGGGATTGTCATGTTGGCAATTTGCTCGAGCAAATTGCCAACATGACAATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020623
PTH MISSION shRNA Bacterial Glycerol Stock
parathyroid hormone
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009621    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020623.1-549s1c1
Sequence:CCGGGTGCTAATACTTCTACTGTAACTCGAGTTACAGTAGAAGTATTAGCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020623.1-185s1c1
Sequence:CCGGCTTACCCAAACGGATGGGAAACTCGAGTTTCCCATCCGTTTGGGTAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020623.1-438s1c1
Sequence:CCGGCTGATGTGGATGTATTAGTTACTCGAGTAACTAATACATCCACATCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020623.1-221s1c1
Sequence:CCGGGCTGTCAGTGAAATACAGCTTCTCGAGAAGCTGTATTTCACTGACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020623.1-394s1c1
Sequence:CCGGCCTTGTTGATGGCAATCCAAACTCGAGTTTGGATTGCCATCAACAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414627    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020623.2-528s21c1
Sequence:CCGGTCAAGCTTATGAAGATCACCACTCGAGTGGTGATCTTCATAAGCTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020623.2-161s21c1
Sequence:CCGGGATCATCATGCTGGCAGTCTGCTCGAGCAGACTGCCAGCATGATGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020623.2-301s21c1
Sequence:CCGGAGCTGCAAGATATGCACAATTCTCGAGAATTGTGCATATCTTGCAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020623
PTH MISSION shRNA shRNA Plasmid DNA
parathyroid hormone
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009621    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020623.1-549s1c1
Sequence:CCGGGTGCTAATACTTCTACTGTAACTCGAGTTACAGTAGAAGTATTAGCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020623.1-185s1c1
Sequence:CCGGCTTACCCAAACGGATGGGAAACTCGAGTTTCCCATCCGTTTGGGTAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020623.1-438s1c1
Sequence:CCGGCTGATGTGGATGTATTAGTTACTCGAGTAACTAATACATCCACATCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020623.1-221s1c1
Sequence:CCGGGCTGTCAGTGAAATACAGCTTCTCGAGAAGCTGTATTTCACTGACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020623.1-394s1c1
Sequence:CCGGCCTTGTTGATGGCAATCCAAACTCGAGTTTGGATTGCCATCAACAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414627    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020623.2-528s21c1
Sequence:CCGGTCAAGCTTATGAAGATCACCACTCGAGTGGTGATCTTCATAAGCTTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020623.2-161s21c1
Sequence:CCGGGATCATCATGCTGGCAGTCTGCTCGAGCAGACTGCCAGCATGATGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020623.2-301s21c1
Sequence:CCGGAGCTGCAAGATATGCACAATTCTCGAGAATTGTGCATATCTTGCAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020623
PTH MISSION shRNA Lentiviral Transduction Particles
parathyroid hormone
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009621    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020623.1-549s1c1
Sequence:CCGGGTGCTAATACTTCTACTGTAACTCGAGTTACAGTAGAAGTATTAGCACTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020623.1-185s1c1
Sequence:CCGGCTTACCCAAACGGATGGGAAACTCGAGTTTCCCATCCGTTTGGGTAAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020623.1-438s1c1
Sequence:CCGGCTGATGTGGATGTATTAGTTACTCGAGTAACTAATACATCCACATCAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020623.1-221s1c1
Sequence:CCGGGCTGTCAGTGAAATACAGCTTCTCGAGAAGCTGTATTTCACTGACAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020623.1-394s1c1
Sequence:CCGGCCTTGTTGATGGCAATCCAAACTCGAGTTTGGATTGCCATCAACAAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414627    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020623.2-528s21c1
Sequence:CCGGTCAAGCTTATGAAGATCACCACTCGAGTGGTGATCTTCATAAGCTTGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020623.2-161s21c1
Sequence:CCGGGATCATCATGCTGGCAGTCTGCTCGAGCAGACTGCCAGCATGATGATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020623.2-301s21c1
Sequence:CCGGAGCTGCAAGATATGCACAATTCTCGAGAATTGTGCATATCTTGCAGCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)