EMAIL THIS PAGE TO A FRIEND

PTK2B

protein tyrosine kinase 2 beta

148 Gene Product Result for
Synonyms: CADTK CAKB FADK2 FAK2 PKB PTK PYK2 RAFTK
UniProtKB ID: Q14289, D3DST0, Q13475, Q14290, Q16709, Q6PID4
Gene ID:
Human(2185) Summary: This gene encodes a cytoplasmic protein tyrosine kinase which is involved in calcium-induced regulation of ion channels and activation of the map kinase signaling pathway. The encoded protein may represent an important signaling intermediate between neuropeptide-activated receptors or neurotransmitters that increase calcium flux and the downstream signals that regulate neuronal activity. The encoded protein undergoes rapid tyrosine phosphorylation and activation in response to increases in the intracellular calcium concentration, nicotinic acetylcholine receptor activation, membrane depolarization, or protein kinase C activation. This protein has been shown to bind CRK-associated substrate, nephrocystin, GTPase regulator associated with FAK, and the SH2 domain of GRB2. The encoded protein is a member of the FAK subfamily of protein tyrosine kinases but lacks significant sequence similarity to kinases from other subfamilies. Four transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(19229) PTK2 protein tyrosine kinase 2 beta
Rat(50646) protein tyrosine kinase 2 beta
chicken(421998) PTK2B protein tyrosine kinase 2 beta
Horse(100054547) PTK2B protein tyrosine kinase 2 beta
domestic cat(101091691) PTK2B protein tyrosine kinase 2 beta
dog(486102) PTK2B protein tyrosine kinase 2 beta
domestic guinea pig(100734027) protein tyrosine kinase 2 beta
naked mole-rat(101714384) protein tyrosine kinase 2 beta
Domestic Rabbit(100342358) PTK2B protein tyrosine kinase 2 beta
cow(541008) PTK2B protein tyrosine kinase 2 beta
sheep(101106906) PTK2B protein tyrosine kinase 2 beta
Gene Class: Cell_Adhesion
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4300173 Anti-phospho-PTK2B (pTyr402) antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunofluorescence, immunohistochemistry, western blot pricing
P6614 Anti-phospho-Pyk2 (pTyr402) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution chicken, human, rat
western blot pricing
SAB4504522 Anti-phospho-PYK2 (pTyr402) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry pricing
SAB4504678 Anti-phospho-PYK2 (pTyr579) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4301334 Anti-phospho-PYK2 (pTyr579) antibody produced in rabbit affinity isolated antibody mouse, human
immunohistochemistry, western blot pricing
SAB4503831 Anti-phospho-PYK2 (pTyr580) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4503830 Anti-phospho-PYK2 (pTyr881) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
K1643 Anti-PTK2B (186-200) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
K1768 Anti-PTK2B (766-780) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB4300468 Anti-PTK2B (Ab-402) antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunofluorescence, immunohistochemistry, western blot pricing
AV32685 Anti-PTK2B (AB1) antibody produced in rabbit affinity isolated antibody bovine, rat, horse, human, rabbit, canine, mouse, guinea pig
western blot pricing
AV32684 Anti-PTK2B (AB2) antibody produced in rabbit IgG fraction of antiserum rabbit, bovine, mouse, canine, guinea pig, horse, human, rat
western blot pricing
SAB1405790 Anti-PTK2B antibody produced in mouse purified immunoglobulin, buffered aqueous solution human, rat
western blot pricing
HPA026091 Anti-PTK2B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab1 Antibody Enhanced Validation human, rat
immunohistochemistry, western blot pricing
HPA026276 Anti-PTK2B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab2 human
immunohistochemistry, western blot pricing
P3902 Anti-Pyk2 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, rat, human
immunohistochemistry, immunoprecipitation (IP), microarray, western blot pricing
SAB4500834 Anti-PYK2 antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB4500835 Anti-PYK2 antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4500836 Anti-PYK2 antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry pricing
SAB4500837 Anti-PYK2 antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing
WH0002185M1 Monoclonal Anti-PTK2B antibody produced in mouse clone 1F9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunoprecipitation (IP), western blot pricing
SAB5300394 Monoclonal Anti-PTK2B antibody produced in mouse clone 5E2D5, ascites fluid human
ELISA, immunohistochemistry, western blot pricing

ELISA

Product # Description Species Add to Cart
 
RAB0986 Phosphotyrosine PTK2B / Protein-tyrosine Kinase 2-beta ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172498 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172498 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172498 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004103 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004103 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004103 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004103 Rosetta Predictions human pricing
NM_173174 Rosetta Predictions human pricing
NM_173175 Rosetta Predictions human pricing
NM_173176 Rosetta Predictions human pricing
NM_017318 Rosetta Predictions rat pricing
NM_172498 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004103 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032249 predicted 3269
2 SASI_Hs01_00032250 predicted 926
3 SASI_Hs01_00032251 predicted 891
4 SASI_Hs01_00032252 predicted 1551
5 SASI_Hs01_00032253 predicted 2139
6 SASI_Hs01_00032254 predicted 1957
7 SASI_Hs01_00032255 predicted 2425
8 SASI_Hs02_00336918 predicted 1482
9 SASI_Hs01_00032256 predicted 2339
10 SASI_Hs02_00336919 predicted 1216
11 SASI_Hs01_00032257 predicted 1226
12 SASI_Hs01_00032258 predicted 2197
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173174 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207544 predicted 3428
2 SASI_Hs01_00207545 predicted 1093
3 SASI_Hs01_00207546 predicted 1048
4 SASI_Hs01_00207547 predicted 1712
5 SASI_Hs01_00207548 predicted 2296
6 SASI_Hs01_00207549 predicted 2124
7 SASI_Hs01_00207550 predicted 2590
8 SASI_Hs02_00368137 predicted 1641
9 SASI_Hs01_00207551 predicted 2500
10 SASI_Hs02_00368138 predicted 1376
11 SASI_Hs01_00207552 predicted 1388
12 SASI_Hs01_00207553 predicted 2350
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173175 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063078 predicted 2653
2 SASI_Hs01_00063079 predicted 440
3 SASI_Hs01_00063080 predicted 396
4 SASI_Hs01_00063081 predicted 1056
5 SASI_Hs01_00063082 predicted 1650
6 SASI_Hs01_00063083 predicted 1464
7 SASI_Hs01_00063084 predicted 1934
8 SASI_Hs02_00368139 predicted 990
9 SASI_Hs01_00063085 predicted 1844
10 SASI_Hs02_00368140 predicted 725
11 SASI_Hs01_00063086 predicted 740
12 SASI_Hs01_00063087 predicted 1699
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173176 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172049 predicted 2805
2 SASI_Hs01_00172050 predicted 461
3 SASI_Hs01_00172051 predicted 417
4 SASI_Hs01_00172052 predicted 1084
5 SASI_Hs01_00172053 predicted 1676
6 SASI_Hs01_00172054 predicted 1498
7 SASI_Hs01_00172055 predicted 1961
8 SASI_Hs02_00368141 predicted 1013
9 SASI_Hs01_00172056 predicted 1875
10 SASI_Hs02_00368142 predicted 752
11 SASI_Hs01_00172057 predicted 768
12 SASI_Hs01_00172058 predicted 1728
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017318 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044067 predicted 1407
2 SASI_Rn01_00044068 predicted 1246
3 SASI_Rn01_00044069 predicted 519
4 SASI_Rn01_00044070 predicted 2338
5 SASI_Rn01_00044071 predicted 1688
6 SASI_Rn01_00044072 predicted 2321
7 SASI_Rn01_00044073 predicted 987
8 SASI_Rn01_00044074 predicted 2258
9 SASI_Rn02_00261769 predicted 1860
10 SASI_Rn02_00261770 predicted 1153
11 SASI_Rn01_00044075 predicted 379
12 SASI_Rn01_00044076 predicted 2792
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172498 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00161910 predicted 2890
2 SASI_Mm01_00161911 predicted 360
3 SASI_Mm01_00161912 predicted 2358
4 SASI_Mm01_00161913 predicted 1900
5 SASI_Mm02_00344083 predicted 1523
6 SASI_Mm01_00161914 predicted 1818
7 SASI_Mm01_00161915 predicted 943
8 SASI_Mm01_00161916 predicted 1097
9 SASI_Mm01_00161917 predicted 1919
10 SASI_Mm01_00161918 predicted 1989
11 SASI_Mm01_00161919 predicted 1395
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172498
PTK2B MISSION shRNA Bacterial Glycerol Stock
protein tyrosine kinase 2 beta
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000361440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172498.3-1708s21c1
Sequence:CCGGATCATGGAACTGTATCCTTATCTCGAGATAAGGATACAGTTCCATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172498.3-1927s21c1
Sequence:CCGGATTGAGGACGAAGACTATTACCTCGAGGTAATAGTCTTCGTCCTCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172498.3-1740s21c1
Sequence:CCGGACACTACCTGGAACGAAATAACTCGAGTTATTTCGTTCCAGGTAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172498.3-2562s21c1
Sequence:CCGGATGCTTGGACCCTATGGTTTACTCGAGTAAACCATAGGGTCCAAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172498.1-804s1c1
Sequence:CCGGCCAACTTTGAACTCCTGGAAACTCGAGTTTCCAGGAGTTCAAAGTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172498.1-2716s1c1
Sequence:CCGGCCTCGTGTACCACAATGTCATCTCGAGATGACATTGTGGTACACGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172498.1-1072s1c1
Sequence:CCGGGCTGACAAGTCAAGATACAAACTCGAGTTTGTATCTTGACTTGTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172498.1-2161s1c1
Sequence:CCGGGCCTGTCCTTTACACACTCATCTCGAGATGAGTGTGTAAAGGACAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172498.1-2242s1c1
Sequence:CCGGCCTCAGTGACATTTATCAGATCTCGAGATCTGATAAATGTCACTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172498
PTK2B MISSION shRNA shRNA Plasmid DNA
protein tyrosine kinase 2 beta
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000361440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172498.3-1708s21c1
Sequence:CCGGATCATGGAACTGTATCCTTATCTCGAGATAAGGATACAGTTCCATGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172498.3-1927s21c1
Sequence:CCGGATTGAGGACGAAGACTATTACCTCGAGGTAATAGTCTTCGTCCTCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172498.3-1740s21c1
Sequence:CCGGACACTACCTGGAACGAAATAACTCGAGTTATTTCGTTCCAGGTAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172498.3-2562s21c1
Sequence:CCGGATGCTTGGACCCTATGGTTTACTCGAGTAAACCATAGGGTCCAAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172498.1-804s1c1
Sequence:CCGGCCAACTTTGAACTCCTGGAAACTCGAGTTTCCAGGAGTTCAAAGTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172498.1-2716s1c1
Sequence:CCGGCCTCGTGTACCACAATGTCATCTCGAGATGACATTGTGGTACACGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172498.1-1072s1c1
Sequence:CCGGGCTGACAAGTCAAGATACAAACTCGAGTTTGTATCTTGACTTGTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172498.1-2161s1c1
Sequence:CCGGGCCTGTCCTTTACACACTCATCTCGAGATGAGTGTGTAAAGGACAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172498.1-2242s1c1
Sequence:CCGGCCTCAGTGACATTTATCAGATCTCGAGATCTGATAAATGTCACTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172498
PTK2B MISSION shRNA Lentiviral Transduction Particles
protein tyrosine kinase 2 beta
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000361440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172498.3-1708s21c1
Sequence:CCGGATCATGGAACTGTATCCTTATCTCGAGATAAGGATACAGTTCCATGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172498.3-1927s21c1
Sequence:CCGGATTGAGGACGAAGACTATTACCTCGAGGTAATAGTCTTCGTCCTCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172498.3-1740s21c1
Sequence:CCGGACACTACCTGGAACGAAATAACTCGAGTTATTTCGTTCCAGGTAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172498.3-2562s21c1
Sequence:CCGGATGCTTGGACCCTATGGTTTACTCGAGTAAACCATAGGGTCCAAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172498.1-804s1c1
Sequence:CCGGCCAACTTTGAACTCCTGGAAACTCGAGTTTCCAGGAGTTCAAAGTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172498.1-2716s1c1
Sequence:CCGGCCTCGTGTACCACAATGTCATCTCGAGATGACATTGTGGTACACGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172498.1-1072s1c1
Sequence:CCGGGCTGACAAGTCAAGATACAAACTCGAGTTTGTATCTTGACTTGTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172498.1-2161s1c1
Sequence:CCGGGCCTGTCCTTTACACACTCATCTCGAGATGAGTGTGTAAAGGACAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172498.1-2242s1c1
Sequence:CCGGCCTCAGTGACATTTATCAGATCTCGAGATCTGATAAATGTCACTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004103
VALIDATED
PTK2B MISSION shRNA Bacterial Glycerol Stock
protein tyrosine kinase 2 beta
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000231523    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_004103.3-4018s21c1
Sequence:CCGGATGGACATGGCAGGCCGATTTCTCGAGAAATCGGCCTGCCATGTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004103.3-2911s21c1
Sequence:CCGGGAGTATCCATCTCCCGTTAACCTCGAGGTTAACGGGAGATGGATACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004103.3-2367s21c1
Sequence:CCGGCATTGAGGACGAGGACTATTACTCGAGTAATAGTCCTCGTCCTCAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_004103.3-2677s21c1
Sequence:CCGGTGCAGCCTCAGTGACGTTTATCTCGAGATAAACGTCACTGAGGCTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010544    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004103.x-4192s1c1
Sequence:CCGGTAATGTGAGTTTGGTCTGGACCTCGAGGTCCAGACCAAACTCACATTATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004103.x-675s1c1
Sequence:CCGGTCGAGTAAAGTTGGGCACGTTCTCGAGAACGTGCCCAACTTTACTCGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_004103.x-1912s1c1
Sequence:CCGGCGTGAAGATGTGGTCCTGAATCTCGAGATTCAGGACCACATCTTCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004103.x-1723s1c1
Sequence:CCGGCAAGGCTCTCTCATCATCCATCTCGAGATGGATGATGAGAGAGCCTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_004103.3-3441s1c1
Sequence:CCGGGCCGTCATCTTCACGGACAGACTCGAGTCTGTCCGTGAAGATGACGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199706    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004103.3-3737s1c1
Sequence:CCGGGCCTTGCTGTTGGTCATGTGGCTCGAGCCACATGACCAACAGCAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_004103.3-763s1c1
Sequence:CCGGCGTATCCTCAAGGTCTGCTTCCTCGAGGAAGCAGACCTTGAGGATACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194657    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004103.3-4005s1c1
Sequence:CCGGCCTAGCTTTATATATGGACATCTCGAGATGTCCATATATAAAGCTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_004103.3-1455s1c1
Sequence:CCGGCATTCAAGGATGGAACATTACCTCGAGGTAATGTTCCATCCTTGAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_004103.3-3277s1c1
Sequence:CCGGGATGACCTGGTGTACCTCAATCTCGAGATTGAGGTACACCAGGTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004103
VALIDATED
PTK2B MISSION shRNA shRNA Plasmid DNA
protein tyrosine kinase 2 beta
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000231523    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_004103.3-4018s21c1
Sequence:CCGGATGGACATGGCAGGCCGATTTCTCGAGAAATCGGCCTGCCATGTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004103.3-2911s21c1
Sequence:CCGGGAGTATCCATCTCCCGTTAACCTCGAGGTTAACGGGAGATGGATACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004103.3-2367s21c1
Sequence:CCGGCATTGAGGACGAGGACTATTACTCGAGTAATAGTCCTCGTCCTCAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_004103.3-2677s21c1
Sequence:CCGGTGCAGCCTCAGTGACGTTTATCTCGAGATAAACGTCACTGAGGCTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010544    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004103.x-4192s1c1
Sequence:CCGGTAATGTGAGTTTGGTCTGGACCTCGAGGTCCAGACCAAACTCACATTATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004103.x-675s1c1
Sequence:CCGGTCGAGTAAAGTTGGGCACGTTCTCGAGAACGTGCCCAACTTTACTCGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_004103.x-1912s1c1
Sequence:CCGGCGTGAAGATGTGGTCCTGAATCTCGAGATTCAGGACCACATCTTCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004103.x-1723s1c1
Sequence:CCGGCAAGGCTCTCTCATCATCCATCTCGAGATGGATGATGAGAGAGCCTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_004103.3-3441s1c1
Sequence:CCGGGCCGTCATCTTCACGGACAGACTCGAGTCTGTCCGTGAAGATGACGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199706    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004103.3-3737s1c1
Sequence:CCGGGCCTTGCTGTTGGTCATGTGGCTCGAGCCACATGACCAACAGCAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_004103.3-763s1c1
Sequence:CCGGCGTATCCTCAAGGTCTGCTTCCTCGAGGAAGCAGACCTTGAGGATACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194657    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004103.3-4005s1c1
Sequence:CCGGCCTAGCTTTATATATGGACATCTCGAGATGTCCATATATAAAGCTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_004103.3-1455s1c1
Sequence:CCGGCATTCAAGGATGGAACATTACCTCGAGGTAATGTTCCATCCTTGAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_004103.3-3277s1c1
Sequence:CCGGGATGACCTGGTGTACCTCAATCTCGAGATTGAGGTACACCAGGTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004103
VALIDATED
PTK2B MISSION shRNA Lentiviral Transduction Particles
protein tyrosine kinase 2 beta
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000231523    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_004103.3-4018s21c1
Sequence:CCGGATGGACATGGCAGGCCGATTTCTCGAGAAATCGGCCTGCCATGTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004103.3-2911s21c1
Sequence:CCGGGAGTATCCATCTCCCGTTAACCTCGAGGTTAACGGGAGATGGATACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004103.3-2367s21c1
Sequence:CCGGCATTGAGGACGAGGACTATTACTCGAGTAATAGTCCTCGTCCTCAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_004103.3-2677s21c1
Sequence:CCGGTGCAGCCTCAGTGACGTTTATCTCGAGATAAACGTCACTGAGGCTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010544    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004103.x-4192s1c1
Sequence:CCGGTAATGTGAGTTTGGTCTGGACCTCGAGGTCCAGACCAAACTCACATTATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004103.x-675s1c1
Sequence:CCGGTCGAGTAAAGTTGGGCACGTTCTCGAGAACGTGCCCAACTTTACTCGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_004103.x-1912s1c1
Sequence:CCGGCGTGAAGATGTGGTCCTGAATCTCGAGATTCAGGACCACATCTTCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004103.x-1723s1c1
Sequence:CCGGCAAGGCTCTCTCATCATCCATCTCGAGATGGATGATGAGAGAGCCTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_004103.3-3441s1c1
Sequence:CCGGGCCGTCATCTTCACGGACAGACTCGAGTCTGTCCGTGAAGATGACGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199706    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004103.3-3737s1c1
Sequence:CCGGGCCTTGCTGTTGGTCATGTGGCTCGAGCCACATGACCAACAGCAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_004103.3-763s1c1
Sequence:CCGGCGTATCCTCAAGGTCTGCTTCCTCGAGGAAGCAGACCTTGAGGATACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194657    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004103.3-4005s1c1
Sequence:CCGGCCTAGCTTTATATATGGACATCTCGAGATGTCCATATATAAAGCTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_004103.3-1455s1c1
Sequence:CCGGCATTCAAGGATGGAACATTACCTCGAGGTAATGTTCCATCCTTGAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_004103.3-3277s1c1
Sequence:CCGGGATGACCTGGTGTACCTCAATCTCGAGATTGAGGTACACCAGGTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)