EMAIL THIS PAGE TO A FRIEND

PTK6

protein tyrosine kinase 6

84 Gene Product Result for
Synonyms: BRK
UniProtKB ID: Q13882, B2RCR3, B4DW46, Q58F01
Gene ID:
Human(5753) Summary: The protein encoded by this gene is a cytoplasmic nonreceptor protein kinase which may function as an intracellular signal transducer in epithelial tissues. Overexpression of this gene in mammary epithelial cells leads to sensitization of the cells to epidermal growth factor and results in a partially transformed phenotype. Expression of this gene has been detected at low levels in some breast tumors but not in normal breast tissue. The encoded protein has been shown to undergo autophosphorylation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
Mouse(20459) PTK6 protein tyrosine kinase 6
Rat(366275) protein tyrosine kinase 6
domestic cat(101100294) PTK6 protein tyrosine kinase 6
Horse(100060532) PTK6 protein tyrosine kinase 6
cow(529814) PTK6 protein tyrosine kinase 6
sheep(101109378) PTK6 protein tyrosine kinase 6
naked mole-rat(101722381) protein tyrosine kinase 6
domestic guinea pig(100731622) protein tyrosine kinase 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4502513 Anti-Breast Tumor Kinase antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence pricing
SAB4502514 Anti-Breast Tumor Kinase antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, western blot pricing
SAB1305409 ANTI-BRK (PTK6)(N-TERMINAL) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB1302529 ANTI-MOUSE PTK6 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
western blot pricing
SAB4504088 Anti-phospho-Breast Tumor Kinase (pTyr447) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence, western blot pricing
K2018 Anti-PTK6 (341-355) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1300420 Anti-PTK6 (N-term) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1406340 Anti-PTK6 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA036070 Anti-PTK6 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB2104904 Anti-PTK6 antibody produced in rabbit affinity isolated antibody human
western blot pricing
HPA036071 Anti-PTK6 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB5300217 Monoclonal Anti-PTK6 antibody produced in mouse clone 2H12B8, ascites fluid human
ELISA, western blot pricing
SAB1402329 Monoclonal Anti-PTK6, (C-terminal) antibody produced in mouse clone 2F11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
T5568 Tyrphostin AG 835 ≥92% human pricing
T5318 Tyrphostin AG 808 ≥98% human, mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009184 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009184 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009184 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005975 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005975 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005975 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005975 Rosetta Predictions human pricing
NM_001108968 Rosetta Predictions rat pricing
NM_009184 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005975 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228044 predicted 253
2 SASI_Hs01_00228045 predicted 1155
3 SASI_Hs01_00228046 predicted 1033
4 SASI_Hs01_00228048 predicted 1337
5 SASI_Hs01_00228049 predicted 374
6 SASI_Hs02_00340655 predicted 1031
7 SASI_Hs01_00228051 predicted 601
8 SASI_Hs01_00228052 predicted 876
9 SASI_Hs01_00228053 predicted 480
10 SASI_Hs02_00340656 predicted 721
11 SASI_Hs01_00228047 predicted 711
12 SASI_Hs01_00228050 predicted 1326
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108968 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243864 predicted 1602
2 SASI_Rn02_00243865 predicted 511
3 SASI_Rn02_00243866 predicted 1616
4 SASI_Rn02_00243867 predicted 1354
5 SASI_Rn02_00243868 predicted 1667
6 SASI_Rn02_00243869 predicted 585
7 SASI_Rn02_00243870 predicted 1106
8 SASI_Rn02_00243871 predicted 1003
9 SASI_Rn02_00243872 predicted 851
10 SASI_Rn02_00243873 predicted 622
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009184 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00115345 predicted 1357
2 SASI_Mm02_00315552 predicted 980
3 SASI_Mm01_00115346 predicted 501
4 SASI_Mm01_00115347 predicted 1362
5 SASI_Mm01_00115348 predicted 617
6 SASI_Mm01_00115350 predicted 348
7 SASI_Mm01_00115351 predicted 1594
8 SASI_Mm01_00115352 predicted 651
9 SASI_Mm01_00115353 predicted 950
10 SASI_Mm02_00315553 predicted 996
11 SASI_Mm01_00115349 predicted 857
12 SASI_Mm01_00115354 predicted 489
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009184
PTK6 MISSION shRNA Bacterial Glycerol Stock
protein tyrosine kinase 6
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009184.1-384s1c1
Sequence:CCGGCCTCCTCCATGTTACCAAGAACTCGAGTTCTTGGTAACATGGAGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009184.1-1606s1c1
Sequence:CCGGCTCACAGGTATCACCAGGTATCTCGAGATACCTGGTGATACCTGTGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009184.1-1365s1c1
Sequence:CCGGCCGAGGGCATTACTCCATCAACTCGAGTTGATGGAGTAATGCCCTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009184.1-1236s1c1
Sequence:CCGGCGTTCTTGTTACAGAGAACAACTCGAGTTGTTCTCTGTAACAAGAACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009184.1-657s1c1
Sequence:CCGGGCGACATTACAGGATCTGGAACTCGAGTTCCAGATCCTGTAATGTCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009184.2-732s21c1
Sequence:CCGGTGAGCTTGTGGACTACCATAACTCGAGTTATGGTAGTCCACAAGCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361528    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009184.2-1668s21c1
Sequence:CCGGAGAAGAGGGCCTCGTGATTATCTCGAGATAATCACGAGGCCCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009184.2-1404s21c1
Sequence:CCGGTGGAGTTCTTCTTCATGAAATCTCGAGATTTCATGAAGAAGAACTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361462    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009184.2-1751s21c1
Sequence:CCGGATACCAAACATACCTCAAATACTCGAGTATTTGAGGTATGTTTGGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009184
PTK6 MISSION shRNA shRNA Plasmid DNA
protein tyrosine kinase 6
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009184.1-384s1c1
Sequence:CCGGCCTCCTCCATGTTACCAAGAACTCGAGTTCTTGGTAACATGGAGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009184.1-1606s1c1
Sequence:CCGGCTCACAGGTATCACCAGGTATCTCGAGATACCTGGTGATACCTGTGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009184.1-1365s1c1
Sequence:CCGGCCGAGGGCATTACTCCATCAACTCGAGTTGATGGAGTAATGCCCTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009184.1-1236s1c1
Sequence:CCGGCGTTCTTGTTACAGAGAACAACTCGAGTTGTTCTCTGTAACAAGAACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009184.1-657s1c1
Sequence:CCGGGCGACATTACAGGATCTGGAACTCGAGTTCCAGATCCTGTAATGTCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009184.2-732s21c1
Sequence:CCGGTGAGCTTGTGGACTACCATAACTCGAGTTATGGTAGTCCACAAGCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361528    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009184.2-1668s21c1
Sequence:CCGGAGAAGAGGGCCTCGTGATTATCTCGAGATAATCACGAGGCCCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009184.2-1404s21c1
Sequence:CCGGTGGAGTTCTTCTTCATGAAATCTCGAGATTTCATGAAGAAGAACTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361462    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009184.2-1751s21c1
Sequence:CCGGATACCAAACATACCTCAAATACTCGAGTATTTGAGGTATGTTTGGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009184
PTK6 MISSION shRNA Lentiviral Transduction Particles
protein tyrosine kinase 6
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009184.1-384s1c1
Sequence:CCGGCCTCCTCCATGTTACCAAGAACTCGAGTTCTTGGTAACATGGAGGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009184.1-1606s1c1
Sequence:CCGGCTCACAGGTATCACCAGGTATCTCGAGATACCTGGTGATACCTGTGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009184.1-1365s1c1
Sequence:CCGGCCGAGGGCATTACTCCATCAACTCGAGTTGATGGAGTAATGCCCTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009184.1-1236s1c1
Sequence:CCGGCGTTCTTGTTACAGAGAACAACTCGAGTTGTTCTCTGTAACAAGAACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009184.1-657s1c1
Sequence:CCGGGCGACATTACAGGATCTGGAACTCGAGTTCCAGATCCTGTAATGTCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009184.2-732s21c1
Sequence:CCGGTGAGCTTGTGGACTACCATAACTCGAGTTATGGTAGTCCACAAGCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361528    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009184.2-1668s21c1
Sequence:CCGGAGAAGAGGGCCTCGTGATTATCTCGAGATAATCACGAGGCCCTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009184.2-1404s21c1
Sequence:CCGGTGGAGTTCTTCTTCATGAAATCTCGAGATTTCATGAAGAAGAACTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361462    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009184.2-1751s21c1
Sequence:CCGGATACCAAACATACCTCAAATACTCGAGTATTTGAGGTATGTTTGGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005975
VALIDATED
PTK6 MISSION shRNA Bacterial Glycerol Stock
protein tyrosine kinase 6
Human
21 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005975.2-867s21c1
Sequence:GTACCGGTCCGCGACTCTGATGAGAAAGCTCGAGCTTTCTCATCAGAGTCGCGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021549    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005975.2-1866s1c1
Sequence:CCGGCCTGTTTGTCTTGTGTCTTGACTCGAGTCAAGACACAAGACAAACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005975.2-689s1c1
Sequence:CCGGGCCATTAAGGTGATTTCTCGACTCGAGTCGAGAAATCACCTTAATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005975.2-1064s1c1
Sequence:CCGGTACCTCTCCCATGACCACAATCTCGAGATTGTGGTCATGGGAGAGGTATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005975.2-951s1c1
Sequence:CCGGAGTCGCAGAATTACATCCACCCTCGAGGGTGGATGTAATTCTGCGACTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005975.2-1065s1c1
Sequence:CCGGACCTCTCCCATGACCACAATACTCGAGTATTGTGGTCATGGGAGAGGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005975.2-261s21c1
Sequence:CCGGAGTCGGAACCGTGGTTCTTTGCTCGAGCAAAGAACCACGGTTCCGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005975.2-1066s21c1
Sequence:CCGGCCTCTCCCATGACCACAATATCTCGAGATATTGTGGTCATGGGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005975.2-677s1c1
Sequence:CCGGCGGGTCCAGGTGGCCATTAAGCTCGAGCTTAATGGCCACCTGGACCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314823    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005975.2-1506s21c1
Sequence:CCGGGTGCAGGAAAGGTTCACAAATCTCGAGATTTGTGAACCTTTCCTGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005975.2-943s21c1
Sequence:CCGGTTACCTGGAGTCGCAGAATTACTCGAGTAATTCTGCGACTCCAGGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005975.2-1123s21c1
Sequence:GTACCGGAGGCCATTACTCCACCAAATCCTCGAGGATTTGGTGGAGTAATGGCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194770    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005975.2-2140s1c1
Sequence:CCGGCATCCATGGTTAAGTCATAAACTCGAGTTTATGACTTAACCATGGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196912    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005975.2-1506s1c1
Sequence:CCGGGTGCAGGAAAGGTTCACAAATCTCGAGATTTGTGAACCTTTCCTGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005975.2-1045s1c1
Sequence:CCGGGCTTATCAAGGAGGACGTCTACTCGAGTAGACGTCCTCCTTGATAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199034    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005975.2-2038s1c1
Sequence:CCGGCCCTCACTCCTGCGCTGACAACTCGAGTTGTCAGCGCAGGAGTGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005975.2-269s1c1
Sequence:CCGGCCGTGGTTCTTTGGCTGCATCCTCGAGGATGCAGCCAAAGAACCACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005975.2-1204s1c1
Sequence:CCGGCCCAGGCATGTCCAACCATGACTCGAGTCATGGTTGGACATGCCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005975.2-865s1c1
Sequence:CCGGGCTCCGCGACTCTGATGAGAACTCGAGTTCTCATCAGAGTCGCGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005975.2-684s21c1
Sequence:CCGGAGGTGGCCATTAAGGTGATTTCTCGAGAAATCACCTTAATGGCCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005975.2-1161s21c1
Sequence:GTACCGGGGATTCTCCTGCATGAGATGTCTCGAGACATCTCATGCAGGAGAATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005975
VALIDATED
PTK6 MISSION shRNA shRNA Plasmid DNA
protein tyrosine kinase 6
Human
21 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005975.2-867s21c1
Sequence:GTACCGGTCCGCGACTCTGATGAGAAAGCTCGAGCTTTCTCATCAGAGTCGCGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021549    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005975.2-1866s1c1
Sequence:CCGGCCTGTTTGTCTTGTGTCTTGACTCGAGTCAAGACACAAGACAAACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005975.2-689s1c1
Sequence:CCGGGCCATTAAGGTGATTTCTCGACTCGAGTCGAGAAATCACCTTAATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005975.2-1064s1c1
Sequence:CCGGTACCTCTCCCATGACCACAATCTCGAGATTGTGGTCATGGGAGAGGTATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005975.2-951s1c1
Sequence:CCGGAGTCGCAGAATTACATCCACCCTCGAGGGTGGATGTAATTCTGCGACTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005975.2-1065s1c1
Sequence:CCGGACCTCTCCCATGACCACAATACTCGAGTATTGTGGTCATGGGAGAGGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005975.2-261s21c1
Sequence:CCGGAGTCGGAACCGTGGTTCTTTGCTCGAGCAAAGAACCACGGTTCCGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005975.2-1066s21c1
Sequence:CCGGCCTCTCCCATGACCACAATATCTCGAGATATTGTGGTCATGGGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005975.2-677s1c1
Sequence:CCGGCGGGTCCAGGTGGCCATTAAGCTCGAGCTTAATGGCCACCTGGACCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314823    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005975.2-1506s21c1
Sequence:CCGGGTGCAGGAAAGGTTCACAAATCTCGAGATTTGTGAACCTTTCCTGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005975.2-943s21c1
Sequence:CCGGTTACCTGGAGTCGCAGAATTACTCGAGTAATTCTGCGACTCCAGGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005975.2-1123s21c1
Sequence:GTACCGGAGGCCATTACTCCACCAAATCCTCGAGGATTTGGTGGAGTAATGGCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194770    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005975.2-2140s1c1
Sequence:CCGGCATCCATGGTTAAGTCATAAACTCGAGTTTATGACTTAACCATGGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196912    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005975.2-1506s1c1
Sequence:CCGGGTGCAGGAAAGGTTCACAAATCTCGAGATTTGTGAACCTTTCCTGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005975.2-1045s1c1
Sequence:CCGGGCTTATCAAGGAGGACGTCTACTCGAGTAGACGTCCTCCTTGATAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199034    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005975.2-2038s1c1
Sequence:CCGGCCCTCACTCCTGCGCTGACAACTCGAGTTGTCAGCGCAGGAGTGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005975.2-269s1c1
Sequence:CCGGCCGTGGTTCTTTGGCTGCATCCTCGAGGATGCAGCCAAAGAACCACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005975.2-1204s1c1
Sequence:CCGGCCCAGGCATGTCCAACCATGACTCGAGTCATGGTTGGACATGCCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005975.2-865s1c1
Sequence:CCGGGCTCCGCGACTCTGATGAGAACTCGAGTTCTCATCAGAGTCGCGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005975.2-684s21c1
Sequence:CCGGAGGTGGCCATTAAGGTGATTTCTCGAGAAATCACCTTAATGGCCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005975.2-1161s21c1
Sequence:GTACCGGGGATTCTCCTGCATGAGATGTCTCGAGACATCTCATGCAGGAGAATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005975
VALIDATED
PTK6 MISSION shRNA Lentiviral Transduction Particles
protein tyrosine kinase 6
Human
21 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005975.2-867s21c1
Sequence:GTACCGGTCCGCGACTCTGATGAGAAAGCTCGAGCTTTCTCATCAGAGTCGCGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021549    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005975.2-1866s1c1
Sequence:CCGGCCTGTTTGTCTTGTGTCTTGACTCGAGTCAAGACACAAGACAAACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005975.2-689s1c1
Sequence:CCGGGCCATTAAGGTGATTTCTCGACTCGAGTCGAGAAATCACCTTAATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005975.2-1064s1c1
Sequence:CCGGTACCTCTCCCATGACCACAATCTCGAGATTGTGGTCATGGGAGAGGTATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005975.2-951s1c1
Sequence:CCGGAGTCGCAGAATTACATCCACCCTCGAGGGTGGATGTAATTCTGCGACTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005975.2-1065s1c1
Sequence:CCGGACCTCTCCCATGACCACAATACTCGAGTATTGTGGTCATGGGAGAGGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005975.2-261s21c1
Sequence:CCGGAGTCGGAACCGTGGTTCTTTGCTCGAGCAAAGAACCACGGTTCCGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005975.2-1066s21c1
Sequence:CCGGCCTCTCCCATGACCACAATATCTCGAGATATTGTGGTCATGGGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005975.2-677s1c1
Sequence:CCGGCGGGTCCAGGTGGCCATTAAGCTCGAGCTTAATGGCCACCTGGACCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314823    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005975.2-1506s21c1
Sequence:CCGGGTGCAGGAAAGGTTCACAAATCTCGAGATTTGTGAACCTTTCCTGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005975.2-943s21c1
Sequence:CCGGTTACCTGGAGTCGCAGAATTACTCGAGTAATTCTGCGACTCCAGGTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005975.2-1123s21c1
Sequence:GTACCGGAGGCCATTACTCCACCAAATCCTCGAGGATTTGGTGGAGTAATGGCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194770    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005975.2-2140s1c1
Sequence:CCGGCATCCATGGTTAAGTCATAAACTCGAGTTTATGACTTAACCATGGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196912    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005975.2-1506s1c1
Sequence:CCGGGTGCAGGAAAGGTTCACAAATCTCGAGATTTGTGAACCTTTCCTGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005975.2-1045s1c1
Sequence:CCGGGCTTATCAAGGAGGACGTCTACTCGAGTAGACGTCCTCCTTGATAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199034    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005975.2-2038s1c1
Sequence:CCGGCCCTCACTCCTGCGCTGACAACTCGAGTTGTCAGCGCAGGAGTGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005975.2-269s1c1
Sequence:CCGGCCGTGGTTCTTTGGCTGCATCCTCGAGGATGCAGCCAAAGAACCACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005975.2-1204s1c1
Sequence:CCGGCCCAGGCATGTCCAACCATGACTCGAGTCATGGTTGGACATGCCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005975.2-865s1c1
Sequence:CCGGGCTCCGCGACTCTGATGAGAACTCGAGTTCTCATCAGAGTCGCGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005975.2-684s21c1
Sequence:CCGGAGGTGGCCATTAAGGTGATTTCTCGAGAAATCACCTTAATGGCCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005975.2-1161s21c1
Sequence:GTACCGGGGATTCTCCTGCATGAGATGTCTCGAGACATCTCATGCAGGAGAATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)