EMAIL THIS PAGE TO A FRIEND

PTK7

protein tyrosine kinase 7

134 Gene Product Result for
Synonyms: CCK-4 CCK4
Gene ID:
Human(5754) Summary: This gene encodes a member of the receptor protein tyrosine kinase family of proteins that transduce extracellular signals across the cell membrane. The encoded protein lacks detectable catalytic tyrosine kinase activity, is involved in the Wnt signaling pathway and plays a role in multiple cellular processes including polarity and adhesion. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
Mouse(71461) PTK7 protein tyrosine kinase 7
Rat(301242) protein tyrosine kinase 7
chicken(421257) PTK7 protein tyrosine kinase 7
Horse(100067287) PTK7 protein tyrosine kinase 7
domestic cat(101093606) PTK7 protein tyrosine kinase 7
dog(481808) PTK7 protein tyrosine kinase 7
domestic guinea pig(100716278) protein tyrosine kinase 7
naked mole-rat(101719352) protein tyrosine kinase 7
cow(514819) PTK7 protein tyrosine kinase 7
sheep(101111135) PTK7 protein tyrosine kinase 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1306159 ANTI-CCK4 (PTK7)(N-TERMINAL) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing
K2143 Anti-PTK7 (361-375) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
K2268 Anti-PTK7 (956-970) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
HPA003222 Anti-PTK7 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry, western blot pricing
SAB3500340 Anti-PTK7 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
WH0005754M2 Monoclonal Anti-PTK7 antibody produced in mouse clone 4C6, purified immunoglobulin, buffered aqueous solution rat, human, mouse
ELISA, immunofluorescence, western blot pricing
SAB1404276 Monoclonal Anti-PTK7 antibody produced in mouse clone 4F5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1409572 Monoclonal Anti-PTK7 antibody produced in mouse clone 4A6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409573 Monoclonal Anti-PTK7 antibody produced in mouse clone 1A8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409574 Monoclonal Anti-PTK7 antibody produced in mouse clone 4D4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
T5568 Tyrphostin AG 835 ≥92% human pricing
T5318 Tyrphostin AG 808 ≥98% human, mouse pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0928 AQUA Peptide INSVEVYDGTLY[R] mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175168 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175168 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175168 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002821 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002821 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002821 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU083581 MISSION® esiRNA esiRNA targeting mouse Ptk7 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002821 Rosetta Predictions human pricing
NM_152880 Rosetta Predictions human pricing
NM_152881 Rosetta Predictions human pricing
NM_152882 Rosetta Predictions human pricing
NM_152883 Rosetta Predictions human pricing
NM_001106889 Rosetta Predictions rat pricing
NM_175168 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002821 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00334520 predicted 2808
2 SASI_Hs02_00334521 predicted 2817
3 SASI_Hs01_00245273 predicted 633
4 SASI_Hs01_00245274 predicted 1168
5 SASI_Hs01_00245275 predicted 1171
6 SASI_Hs01_00245276 predicted 3287
7 SASI_Hs01_00245277 predicted 546
8 SASI_Hs01_00245278 predicted 901
9 SASI_Hs01_00245280 predicted 3175
10 SASI_Hs01_00245281 predicted 830
11 SASI_Hs01_00245272 predicted 3626
12 SASI_Hs01_00245279 predicted 1149
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152880 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366846 predicted 2687
2 SASI_Hs02_00366847 predicted 2698
3 SASI_Hs01_00029741 predicted 629
4 SASI_Hs01_00029742 predicted 1166
5 SASI_Hs01_00029743 predicted 1176
6 SASI_Hs01_00029744 predicted 3167
7 SASI_Hs01_00029745 predicted 549
8 SASI_Hs01_00029746 predicted 907
9 SASI_Hs01_00029748 predicted 3055
10 SASI_Hs01_00029749 predicted 827
11 SASI_Hs01_00029740 predicted 3506
12 SASI_Hs01_00029747 predicted 1140
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152881 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366848 predicted 2414
2 SASI_Hs02_00366849 predicted 2426
3 SASI_Hs01_00241569 predicted 633
4 SASI_Hs01_00241570 predicted 1174
5 SASI_Hs01_00241571 predicted 1167
6 SASI_Hs01_00241572 predicted 2905
7 SASI_Hs01_00241573 predicted 544
8 SASI_Hs01_00241574 predicted 909
9 SASI_Hs01_00241576 predicted 2787
10 SASI_Hs01_00241577 predicted 834
11 SASI_Hs01_00241568 predicted 3231
12 SASI_Hs01_00241575 predicted 1147
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152882 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366850 predicted 2634
2 SASI_Hs02_00366851 predicted 2647
3 SASI_Hs01_00232568 predicted 627
4 SASI_Hs01_00232569 predicted 1168
5 SASI_Hs01_00232570 predicted 1174
6 SASI_Hs01_00232571 predicted 3123
7 SASI_Hs01_00232572 predicted 543
8 SASI_Hs01_00232573 predicted 908
9 SASI_Hs01_00232575 predicted 3003
10 SASI_Hs01_00232576 predicted 829
11 SASI_Hs01_00232567 predicted 3456
12 SASI_Hs01_00232574 predicted 1142
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152883 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070963 predicted 982
2 SASI_Hs01_00070964 predicted 1170
3 SASI_Hs01_00070965 predicted 770
4 SASI_Hs01_00070966 predicted 1181
5 SASI_Hs01_00070967 predicted 3065
6 SASI_Hs01_00070968 predicted 910
7 SASI_Hs01_00070969 predicted 635
8 SASI_Hs01_00070970 predicted 469
9 SASI_Hs01_00070971 predicted 1141
10 SASI_Hs01_00070972 predicted 907
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106889 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223406 predicted 1752
2 SASI_Rn02_00223407 predicted 1932
3 SASI_Rn02_00223408 predicted 1471
4 SASI_Rn02_00223409 predicted 1298
5 SASI_Rn02_00223410 predicted 2398
6 SASI_Rn02_00223411 predicted 967
7 SASI_Rn02_00223412 predicted 1596
8 SASI_Rn02_00223413 predicted 1669
9 SASI_Rn02_00223414 predicted 2964
10 SASI_Rn02_00223415 predicted 809
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175168 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047235 predicted 436
2 SASI_Mm01_00047236 predicted 398
3 SASI_Mm01_00047237 predicted 1863
4 SASI_Mm01_00047238 predicted 1715
5 SASI_Mm01_00047239 predicted 1082
6 SASI_Mm01_00047241 predicted 1249
7 SASI_Mm01_00047242 predicted 1951
8 SASI_Mm02_00345805 predicted 1480
9 SASI_Mm01_00047243 predicted 1375
10 SASI_Mm01_00047244 predicted 808
11 SASI_Mm01_00047240 predicted 1733
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175168
VALIDATED
PTK7 MISSION shRNA Bacterial Glycerol Stock
protein tyrosine kinase 7
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000361795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175168.3-2263s21c1
Sequence:CCGGTACTGCAAGAAGCGGTGTAAACTCGAGTTTACACCGCTTCTTGCAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175168.3-173s21c1
Sequence:CCGGCCCAAGCCGCTATCGTCTTTACTCGAGTAAAGACGATAGCGGCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175168.3-1286s21c1
Sequence:CCGGAGCGGCGACAGGATGTCAATACTCGAGTATTGACATCCTGTCGCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175168.2-1237s1c1
Sequence:CCGGTGAGAGTGATACTGGTGTCTACTCGAGTAGACACCAGTATCACTCTCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175168.2-175s1c1
Sequence:CCGGCCAAGCCGCTATCGTCTTTATCTCGAGATAAAGACGATAGCGGCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175168.2-2728s1c1
Sequence:CCGGCCTGGGAGATCTCAAACAGTTCTCGAGAACTGTTTGAGATCTCCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175168.2-815s1c1
Sequence:CCGGGCCATGTTCCATTGCCAGTTTCTCGAGAAACTGGCAATGGAACATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175168.2-2263s1c1
Sequence:CCGGCTACTGCAAGAAGCGGTGTAACTCGAGTTACACCGCTTCTTGCAGTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175168
VALIDATED
PTK7 MISSION shRNA shRNA Plasmid DNA
protein tyrosine kinase 7
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000361795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175168.3-2263s21c1
Sequence:CCGGTACTGCAAGAAGCGGTGTAAACTCGAGTTTACACCGCTTCTTGCAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175168.3-173s21c1
Sequence:CCGGCCCAAGCCGCTATCGTCTTTACTCGAGTAAAGACGATAGCGGCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175168.3-1286s21c1
Sequence:CCGGAGCGGCGACAGGATGTCAATACTCGAGTATTGACATCCTGTCGCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175168.2-1237s1c1
Sequence:CCGGTGAGAGTGATACTGGTGTCTACTCGAGTAGACACCAGTATCACTCTCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175168.2-175s1c1
Sequence:CCGGCCAAGCCGCTATCGTCTTTATCTCGAGATAAAGACGATAGCGGCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175168.2-2728s1c1
Sequence:CCGGCCTGGGAGATCTCAAACAGTTCTCGAGAACTGTTTGAGATCTCCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175168.2-815s1c1
Sequence:CCGGGCCATGTTCCATTGCCAGTTTCTCGAGAAACTGGCAATGGAACATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175168.2-2263s1c1
Sequence:CCGGCTACTGCAAGAAGCGGTGTAACTCGAGTTACACCGCTTCTTGCAGTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175168
VALIDATED
PTK7 MISSION shRNA Lentiviral Transduction Particles
protein tyrosine kinase 7
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000361795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175168.3-2263s21c1
Sequence:CCGGTACTGCAAGAAGCGGTGTAAACTCGAGTTTACACCGCTTCTTGCAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175168.3-173s21c1
Sequence:CCGGCCCAAGCCGCTATCGTCTTTACTCGAGTAAAGACGATAGCGGCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175168.3-1286s21c1
Sequence:CCGGAGCGGCGACAGGATGTCAATACTCGAGTATTGACATCCTGTCGCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175168.2-1237s1c1
Sequence:CCGGTGAGAGTGATACTGGTGTCTACTCGAGTAGACACCAGTATCACTCTCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175168.2-175s1c1
Sequence:CCGGCCAAGCCGCTATCGTCTTTATCTCGAGATAAAGACGATAGCGGCTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175168.2-2728s1c1
Sequence:CCGGCCTGGGAGATCTCAAACAGTTCTCGAGAACTGTTTGAGATCTCCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175168.2-815s1c1
Sequence:CCGGGCCATGTTCCATTGCCAGTTTCTCGAGAAACTGGCAATGGAACATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175168.2-2263s1c1
Sequence:CCGGCTACTGCAAGAAGCGGTGTAACTCGAGTTACACCGCTTCTTGCAGTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002821
VALIDATED
PTK7 MISSION shRNA Bacterial Glycerol Stock
protein tyrosine kinase 7
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002821.3-276s1c1
Sequence:CCGGCGGTACCCAGACAGCCATTGTCTCGAGACAATGGCTGTCTGGGTACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199565    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002821.3-3740s1c1
Sequence:CCGGGCCACTCATCTGCCAACTTTGCTCGAGCAAAGTTGGCAGATGAGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002821.3-2808s1c1
Sequence:CCGGCCACTACATGGTGCTGGAATACTCGAGTATTCCAGCACCATGTAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006431    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_002821.3-3831s1c1
Sequence:CCGGCACAGGGTTAATGAGTCTCTTCTCGAGAAGAGACTCATTAACCCTGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002821.3-845s1c1
Sequence:CCGGCCTTGAGCATTGCTGATGAAACTCGAGTTTCATCAGCAATGCTCAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_002821.3-2544s1c1
Sequence:CCGGCCACAGCACAAGTGATAAGATCTCGAGATCTTATCACTTGTGCTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_002821.3-2361s1c1
Sequence:CCGGCCTCATGTTCTACTGCAAGAACTCGAGTTCTTGCAGTAGAACATGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_002821.3-2856s1c1
Sequence:CCGGCCTGAGGATTTCCAAGAGCAACTCGAGTTGCTCTTGGAAATCCTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002821.3-923s1c1
Sequence:CCGGCCATGTTCCATTGCCAGTTCTCTCGAGAGAACTGGCAATGGAACATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002821.3-3235s1c1
Sequence:CCGGGATGAAGTACTGGCAGATTTGCTCGAGCAAATCTGCCAGTACTTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002821
VALIDATED
PTK7 MISSION shRNA shRNA Plasmid DNA
protein tyrosine kinase 7
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002821.3-276s1c1
Sequence:CCGGCGGTACCCAGACAGCCATTGTCTCGAGACAATGGCTGTCTGGGTACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199565    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002821.3-3740s1c1
Sequence:CCGGGCCACTCATCTGCCAACTTTGCTCGAGCAAAGTTGGCAGATGAGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002821.3-2808s1c1
Sequence:CCGGCCACTACATGGTGCTGGAATACTCGAGTATTCCAGCACCATGTAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006431    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_002821.3-3831s1c1
Sequence:CCGGCACAGGGTTAATGAGTCTCTTCTCGAGAAGAGACTCATTAACCCTGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002821.3-845s1c1
Sequence:CCGGCCTTGAGCATTGCTGATGAAACTCGAGTTTCATCAGCAATGCTCAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_002821.3-2544s1c1
Sequence:CCGGCCACAGCACAAGTGATAAGATCTCGAGATCTTATCACTTGTGCTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_002821.3-2361s1c1
Sequence:CCGGCCTCATGTTCTACTGCAAGAACTCGAGTTCTTGCAGTAGAACATGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_002821.3-2856s1c1
Sequence:CCGGCCTGAGGATTTCCAAGAGCAACTCGAGTTGCTCTTGGAAATCCTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002821.3-923s1c1
Sequence:CCGGCCATGTTCCATTGCCAGTTCTCTCGAGAGAACTGGCAATGGAACATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002821.3-3235s1c1
Sequence:CCGGGATGAAGTACTGGCAGATTTGCTCGAGCAAATCTGCCAGTACTTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002821
VALIDATED
PTK7 MISSION shRNA Lentiviral Transduction Particles
protein tyrosine kinase 7
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002821.3-276s1c1
Sequence:CCGGCGGTACCCAGACAGCCATTGTCTCGAGACAATGGCTGTCTGGGTACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199565    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002821.3-3740s1c1
Sequence:CCGGGCCACTCATCTGCCAACTTTGCTCGAGCAAAGTTGGCAGATGAGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002821.3-2808s1c1
Sequence:CCGGCCACTACATGGTGCTGGAATACTCGAGTATTCCAGCACCATGTAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006431    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_002821.3-3831s1c1
Sequence:CCGGCACAGGGTTAATGAGTCTCTTCTCGAGAAGAGACTCATTAACCCTGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002821.3-845s1c1
Sequence:CCGGCCTTGAGCATTGCTGATGAAACTCGAGTTTCATCAGCAATGCTCAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_002821.3-2544s1c1
Sequence:CCGGCCACAGCACAAGTGATAAGATCTCGAGATCTTATCACTTGTGCTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_002821.3-2361s1c1
Sequence:CCGGCCTCATGTTCTACTGCAAGAACTCGAGTTCTTGCAGTAGAACATGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_002821.3-2856s1c1
Sequence:CCGGCCTGAGGATTTCCAAGAGCAACTCGAGTTGCTCTTGGAAATCCTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002821.3-923s1c1
Sequence:CCGGCCATGTTCCATTGCCAGTTCTCTCGAGAGAACTGGCAATGGAACATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002821.3-3235s1c1
Sequence:CCGGGATGAAGTACTGGCAGATTTGCTCGAGCAAATCTGCCAGTACTTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)