EMAIL THIS PAGE TO A FRIEND

PTMA

prothymosin, alpha

50 Gene Product Result for
Synonyms: TMSA
UniProtKB ID: P06454, Q15249, Q15592
Gene ID:
Mouse(19231) prothymosin alpha
Rat(29222) prothymosin alpha
chicken(424931) prothymosin, alpha
dog(610128) prothymosin, alpha
cow(615626) prothymosin, alpha (gene sequence 28)
cow(786336) prothymosin, alpha
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008972 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008972 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008972 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002823 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002823 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002823 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099285 Rosetta Predictions human pricing
NM_002823 Rosetta Predictions human pricing
NM_021740 Rosetta Predictions rat pricing
NM_008972 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099285 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320417 predicted 286
2 SASI_Hs02_00320418 predicted 280
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002823 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165836 predicted 678
2 SASI_Hs01_00165837 predicted 573
3 SASI_Hs01_00165838 predicted 681
4 SASI_Hs01_00165839 predicted 577
5 SASI_Hs01_00165840 predicted 589
6 SASI_Hs01_00165841 predicted 474
7 SASI_Hs01_00165842 predicted 191
8 SASI_Hs01_00165843 predicted 604
9 SASI_Hs01_00165844 predicted 898
10 SASI_Hs01_00165845 predicted 1016
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021740 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039102 predicted 227
2 SASI_Rn01_00039103 predicted 616
3 SASI_Rn02_00262757 predicted 978
4 SASI_Rn02_00262758 predicted 471
5 SASI_Rn02_00262759 predicted 948
6 SASI_Rn02_00262760 predicted 524
7 SASI_Rn01_00039108 predicted 552
8 SASI_Rn02_00262761 predicted 559
9 SASI_Rn02_00262762 predicted 971
10 SASI_Rn02_00262763 predicted 975
11 SASI_Rn01_00039104 predicted 855
12 SASI_Rn01_00039105 predicted 508
13 SASI_Rn01_00039106 predicted 861
14 SASI_Rn01_00039107 predicted 161
15 SASI_Rn01_00039109 predicted 841
16 SASI_Rn01_00039110 predicted 865
17 SASI_Rn01_00039111 predicted 401
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008972 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150315 predicted 182
2 SASI_Mm01_00150318 predicted 180
3 SASI_Mm01_00150316 predicted 490
4 SASI_Mm01_00150317 predicted 496
5 SASI_Mm01_00150319 predicted 185
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008972
PTMA MISSION shRNA Bacterial Glycerol Stock
prothymosin, alpha
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008972.1-447s1c1
Sequence:CCGGGAGGATGATGAGGATGACGATCTCGAGATCGTCATCCTCATCATCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008972.1-315s1c1
Sequence:CCGGGCTGACAATGAGGTAGATGAACTCGAGTTCATCTACCTCATTGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008972.1-246s1c1
Sequence:CCGGGAGGCAGAGAATGGAAGAGATCTCGAGATCTCTTCCATTCTCTGCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008972.1-212s1c1
Sequence:CCGGCAAGGACTTGAAGGAGAAGAACTCGAGTTCTTCTCCTTCAAGTCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125359    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008972.1-1012s1c1
Sequence:CCGGCTGTACTATAAGTAGTTGGTTCTCGAGAACCAACTACTTATAGTACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008972.2-487s21c1
Sequence:CCGGAGACCGAGGAGGATGACTAGACTCGAGTCTAGTCATCCTCCTCGGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417585    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008972.2-555s21c1
Sequence:CCGGACTTCCCGTCTCAGAATTTAACTCGAGTTAAATTCTGAGACGGGAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008972
PTMA MISSION shRNA shRNA Plasmid DNA
prothymosin, alpha
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008972.1-447s1c1
Sequence:CCGGGAGGATGATGAGGATGACGATCTCGAGATCGTCATCCTCATCATCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008972.1-315s1c1
Sequence:CCGGGCTGACAATGAGGTAGATGAACTCGAGTTCATCTACCTCATTGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008972.1-246s1c1
Sequence:CCGGGAGGCAGAGAATGGAAGAGATCTCGAGATCTCTTCCATTCTCTGCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008972.1-212s1c1
Sequence:CCGGCAAGGACTTGAAGGAGAAGAACTCGAGTTCTTCTCCTTCAAGTCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125359    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008972.1-1012s1c1
Sequence:CCGGCTGTACTATAAGTAGTTGGTTCTCGAGAACCAACTACTTATAGTACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008972.2-487s21c1
Sequence:CCGGAGACCGAGGAGGATGACTAGACTCGAGTCTAGTCATCCTCCTCGGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417585    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008972.2-555s21c1
Sequence:CCGGACTTCCCGTCTCAGAATTTAACTCGAGTTAAATTCTGAGACGGGAAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008972
PTMA MISSION shRNA Lentiviral Transduction Particles
prothymosin, alpha
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008972.1-447s1c1
Sequence:CCGGGAGGATGATGAGGATGACGATCTCGAGATCGTCATCCTCATCATCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008972.1-315s1c1
Sequence:CCGGGCTGACAATGAGGTAGATGAACTCGAGTTCATCTACCTCATTGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008972.1-246s1c1
Sequence:CCGGGAGGCAGAGAATGGAAGAGATCTCGAGATCTCTTCCATTCTCTGCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008972.1-212s1c1
Sequence:CCGGCAAGGACTTGAAGGAGAAGAACTCGAGTTCTTCTCCTTCAAGTCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125359    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008972.1-1012s1c1
Sequence:CCGGCTGTACTATAAGTAGTTGGTTCTCGAGAACCAACTACTTATAGTACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008972.2-487s21c1
Sequence:CCGGAGACCGAGGAGGATGACTAGACTCGAGTCTAGTCATCCTCCTCGGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417585    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008972.2-555s21c1
Sequence:CCGGACTTCCCGTCTCAGAATTTAACTCGAGTTAAATTCTGAGACGGGAAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002823
VALIDATED
PTMA MISSION shRNA Bacterial Glycerol Stock
prothymosin, alpha
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002823.2-461s1c1
Sequence:CCGGGATGAGGATGACGATGTCGATCTCGAGATCGACATCGTCATCCTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002823.2-455s1c1
Sequence:CCGGGAAGATGATGAGGATGACGATCTCGAGATCGTCATCCTCATCATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133816    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002823.2-682s1c1
Sequence:CCGGCCAAACCATGAGAATTTGCAACTCGAGTTGCAAATTCTCATGGTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002823.2-335s1c1
Sequence:CCGGGTAGACGAAGAAGAGGAAGAACTCGAGTTCTTCCTCTTCTTCGTCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002823.2-449s1c1
Sequence:CCGGGCAGCTGAAGATGATGAGGATCTCGAGATCCTCATCATCTTCAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002823.2-413s1c1
Sequence:CCGGGAAGATGAGGAAGCTGAGTCACTCGAGTGACTCAGCTTCCTCATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002823.2-365s1c1
Sequence:CCGGGAAGAGGAGGAGGAAGAAGAACTCGAGTTCTTCTTCCTCCTCCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002823.2-245s1c1
Sequence:CCGGGAAGTTGTGGAAGAGGCAGAACTCGAGTTCTGCCTCTTCCACAACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134223    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002823.2-1021s1c1
Sequence:CCGGGCTGTACTATAAGTAGTTGGTCTCGAGACCAACTACTTATAGTACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429553    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002823.4-982s21c1
Sequence:CCGGTATTCCGAGCATTCCAGTAACCTCGAGGTTACTGGAATGCTCGGAATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002823.4-216s21c1
Sequence:CCGGATCACCACCAAGGACTTAAAGCTCGAGCTTTAAGTCCTTGGTGGTGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002823
VALIDATED
PTMA MISSION shRNA shRNA Plasmid DNA
prothymosin, alpha
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002823.2-461s1c1
Sequence:CCGGGATGAGGATGACGATGTCGATCTCGAGATCGACATCGTCATCCTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002823.2-455s1c1
Sequence:CCGGGAAGATGATGAGGATGACGATCTCGAGATCGTCATCCTCATCATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133816    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002823.2-682s1c1
Sequence:CCGGCCAAACCATGAGAATTTGCAACTCGAGTTGCAAATTCTCATGGTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002823.2-335s1c1
Sequence:CCGGGTAGACGAAGAAGAGGAAGAACTCGAGTTCTTCCTCTTCTTCGTCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002823.2-449s1c1
Sequence:CCGGGCAGCTGAAGATGATGAGGATCTCGAGATCCTCATCATCTTCAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002823.2-413s1c1
Sequence:CCGGGAAGATGAGGAAGCTGAGTCACTCGAGTGACTCAGCTTCCTCATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002823.2-365s1c1
Sequence:CCGGGAAGAGGAGGAGGAAGAAGAACTCGAGTTCTTCTTCCTCCTCCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002823.2-245s1c1
Sequence:CCGGGAAGTTGTGGAAGAGGCAGAACTCGAGTTCTGCCTCTTCCACAACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134223    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002823.2-1021s1c1
Sequence:CCGGGCTGTACTATAAGTAGTTGGTCTCGAGACCAACTACTTATAGTACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429553    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002823.4-982s21c1
Sequence:CCGGTATTCCGAGCATTCCAGTAACCTCGAGGTTACTGGAATGCTCGGAATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002823.4-216s21c1
Sequence:CCGGATCACCACCAAGGACTTAAAGCTCGAGCTTTAAGTCCTTGGTGGTGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002823
VALIDATED
PTMA MISSION shRNA Lentiviral Transduction Particles
prothymosin, alpha
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002823.2-461s1c1
Sequence:CCGGGATGAGGATGACGATGTCGATCTCGAGATCGACATCGTCATCCTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002823.2-455s1c1
Sequence:CCGGGAAGATGATGAGGATGACGATCTCGAGATCGTCATCCTCATCATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133816    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002823.2-682s1c1
Sequence:CCGGCCAAACCATGAGAATTTGCAACTCGAGTTGCAAATTCTCATGGTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002823.2-335s1c1
Sequence:CCGGGTAGACGAAGAAGAGGAAGAACTCGAGTTCTTCCTCTTCTTCGTCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002823.2-449s1c1
Sequence:CCGGGCAGCTGAAGATGATGAGGATCTCGAGATCCTCATCATCTTCAGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002823.2-413s1c1
Sequence:CCGGGAAGATGAGGAAGCTGAGTCACTCGAGTGACTCAGCTTCCTCATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002823.2-365s1c1
Sequence:CCGGGAAGAGGAGGAGGAAGAAGAACTCGAGTTCTTCTTCCTCCTCCTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002823.2-245s1c1
Sequence:CCGGGAAGTTGTGGAAGAGGCAGAACTCGAGTTCTGCCTCTTCCACAACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134223    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002823.2-1021s1c1
Sequence:CCGGGCTGTACTATAAGTAGTTGGTCTCGAGACCAACTACTTATAGTACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429553    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002823.4-982s21c1
Sequence:CCGGTATTCCGAGCATTCCAGTAACCTCGAGGTTACTGGAATGCTCGGAATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002823.4-216s21c1
Sequence:CCGGATCACCACCAAGGACTTAAAGCTCGAGCTTTAAGTCCTTGGTGGTGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)