EMAIL THIS PAGE TO A FRIEND

PTOV1

prostate tumor overexpressed 1

158 Gene Product Result for
Synonyms: ACID2 PTOV-1
UniProtKB ID: Q86YD1, Q6UXX7, Q96BU3, Q9HBN4, Q9NYL1
Gene ID:
Mouse(84113) prostate tumor over expressed gene 1
Rat(292888) prostate tumor overexpressed 1
domestic cat(101101179) prostate tumor overexpressed 1
dog(612927) prostate tumor overexpressed 1
cow(617775) prostate tumor overexpressed 1
sheep(101113953) prostate tumor overexpressed 1
naked mole-rat(101713799) prostate tumor overexpressed 1
domestic guinea pig(100722327) prostate tumor overexpressed 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017432 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017432 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017432 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133949 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133949 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133949 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017432 Rosetta Predictions human pricing
NM_001008304 Rosetta Predictions rat pricing
NM_133949 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017432 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084823 predicted 1158
2 SASI_Hs02_00350004 predicted 908
3 SASI_Hs01_00084829 predicted 639
4 SASI_Hs02_00350005 predicted 985
5 SASI_Hs02_00350006 predicted 1128
6 SASI_Hs02_00350007 predicted 853
7 SASI_Hs02_00350008 predicted 947
8 SASI_Hs01_00084821 predicted 1257
9 SASI_Hs01_00084822 predicted 1242
10 SASI_Hs01_00084825 predicted 1244
11 SASI_Hs01_00084820 predicted 1254
12 SASI_Hs01_00084824 predicted 785
13 SASI_Hs01_00084826 predicted 1063
14 SASI_Hs01_00084827 predicted 834
15 SASI_Hs01_00084828 predicted 492
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008304 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110883 predicted 1258
2 SASI_Rn01_00110887 predicted 1200
3 SASI_Rn02_00199020 predicted 845
4 SASI_Rn01_00110892 predicted 1075
5 SASI_Rn02_00199021 predicted 879
6 SASI_Rn02_00199022 predicted 1009
7 SASI_Rn02_00199023 predicted 414
8 SASI_Rn02_00199024 predicted 1249
9 SASI_Rn01_00110888 predicted 1243
10 SASI_Rn02_00199025 predicted 1413
11 SASI_Rn01_00110884 predicted 717
12 SASI_Rn01_00110885 predicted 778
13 SASI_Rn01_00110886 predicted 602
14 SASI_Rn01_00110889 predicted 764
15 SASI_Rn01_00110890 predicted 727
16 SASI_Rn01_00110891 predicted 727
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133949 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00194739 predicted 594
2 SASI_Mm01_00194740 predicted 1278
3 SASI_Mm01_00194741 predicted 1360
4 SASI_Mm01_00194742 predicted 949
5 SASI_Mm01_00194743 predicted 1248
6 SASI_Mm01_00194744 predicted 1034
7 SASI_Mm01_00194745 predicted 1081
8 SASI_Mm01_00194746 predicted 1411
9 SASI_Mm01_00194747 predicted 1233
10 SASI_Mm01_00194748 predicted 570
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017432
VALIDATED
PTOV1 MISSION shRNA Bacterial Glycerol Stock
prostate tumor overexpressed 1
Human
20 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017432.3-788s21c1
Sequence:CCGGGTACTCGTCCAAGAAGAAGATCTCGAGATCTTCTTCTTGGACGAGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017432.3-927s21c1
Sequence:CCGGGTCAACAACAAGTTTCTGGCACTCGAGTGCCAGAAACTTGTTGTTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017432.3-662s21c1
Sequence:CCGGGTTCCACTTCACCAACAGAGACTCGAGTCTCTGTTGGTGAAGTGGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017432.2-728s1c1
Sequence:CCGGGTCCAAGAAGAAGATCTTCATCTCGAGATGAAGATCTTCTTCTTGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017432.2-1199s1c1
Sequence:CCGGGCTCCTGTACTCTTCAGAGAACTCGAGTTCTCTGAAGAGTACAGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017432.2-518s1c1
Sequence:CCGGGAAGCTGATCATGCAGCTGATCTCGAGATCAGCTGCATGATCAGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017432.2-1202s1c1
Sequence:CCGGCCTGTACTCTTCAGAGAAGAACTCGAGTTCTTCTCTGAAGAGTACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017432.3-491s21c1
Sequence:CCGGCTACTCTGACTCCACTGCAAACTCGAGTTTGCAGTGGAGTCAGAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017432.3-1268s21c1
Sequence:CCGGCCTGTACTCTTCAGAGAAGAACTCGAGTTCTTCTCTGAAGAGTACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017432.2-1004s1c1
Sequence:CCGGGAAGCTGTACATGCAGCTCATCTCGAGATGAGCTGCATGTACAGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017432.2-1165s1c1
Sequence:CCGGCCTACAAAGCATCGTGTGAGACTCGAGTCTCACACGATGCTTTGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017432.2-719s1c1
Sequence:CCGGCCTGTACTCGTCCAAGAAGAACTCGAGTTCTTCTTGGACGAGTACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017432.2-594s1c1
Sequence:CCGGCAGTTCCACTTCACCAACAGACTCGAGTCTGTTGGTGAAGTGGAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017432.2-425s1c1
Sequence:CCGGCTACTCTGACTCCACTGCAAACTCGAGTTTGCAGTGGAGTCAGAGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017432.2-596s1c1
Sequence:CCGGGTTCCACTTCACCAACAGAGACTCGAGTCTCTGTTGGTGAAGTGGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017432.2-855s1c1
Sequence:CCGGCAGATCGTCAACAACAAGTTTCTCGAGAAACTTGTTGTTGACGATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017432.2-861s1c1
Sequence:CCGGGTCAACAACAAGTTTCTGGCACTCGAGTGCCAGAAACTTGTTGTTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017432.2-722s1c1
Sequence:CCGGGTACTCGTCCAAGAAGAAGATCTCGAGATCTTCTTCTTGGACGAGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017432.2-725s1c1
Sequence:CCGGCTCGTCCAAGAAGAAGATCTTCTCGAGAAGATCTTCTTCTTGGACGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017432.2-737s1c1
Sequence:CCGGGAAGATCTTCATGGGCCTCATCTCGAGATGAGGCCCATGAAGATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017432
VALIDATED
PTOV1 MISSION shRNA shRNA Plasmid DNA
prostate tumor overexpressed 1
Human
20 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017432.3-788s21c1
Sequence:CCGGGTACTCGTCCAAGAAGAAGATCTCGAGATCTTCTTCTTGGACGAGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017432.3-927s21c1
Sequence:CCGGGTCAACAACAAGTTTCTGGCACTCGAGTGCCAGAAACTTGTTGTTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017432.3-662s21c1
Sequence:CCGGGTTCCACTTCACCAACAGAGACTCGAGTCTCTGTTGGTGAAGTGGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017432.2-728s1c1
Sequence:CCGGGTCCAAGAAGAAGATCTTCATCTCGAGATGAAGATCTTCTTCTTGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017432.2-1199s1c1
Sequence:CCGGGCTCCTGTACTCTTCAGAGAACTCGAGTTCTCTGAAGAGTACAGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017432.2-518s1c1
Sequence:CCGGGAAGCTGATCATGCAGCTGATCTCGAGATCAGCTGCATGATCAGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017432.2-1202s1c1
Sequence:CCGGCCTGTACTCTTCAGAGAAGAACTCGAGTTCTTCTCTGAAGAGTACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017432.3-491s21c1
Sequence:CCGGCTACTCTGACTCCACTGCAAACTCGAGTTTGCAGTGGAGTCAGAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017432.3-1268s21c1
Sequence:CCGGCCTGTACTCTTCAGAGAAGAACTCGAGTTCTTCTCTGAAGAGTACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017432.2-1004s1c1
Sequence:CCGGGAAGCTGTACATGCAGCTCATCTCGAGATGAGCTGCATGTACAGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017432.2-1165s1c1
Sequence:CCGGCCTACAAAGCATCGTGTGAGACTCGAGTCTCACACGATGCTTTGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017432.2-719s1c1
Sequence:CCGGCCTGTACTCGTCCAAGAAGAACTCGAGTTCTTCTTGGACGAGTACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017432.2-594s1c1
Sequence:CCGGCAGTTCCACTTCACCAACAGACTCGAGTCTGTTGGTGAAGTGGAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017432.2-425s1c1
Sequence:CCGGCTACTCTGACTCCACTGCAAACTCGAGTTTGCAGTGGAGTCAGAGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017432.2-596s1c1
Sequence:CCGGGTTCCACTTCACCAACAGAGACTCGAGTCTCTGTTGGTGAAGTGGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017432.2-855s1c1
Sequence:CCGGCAGATCGTCAACAACAAGTTTCTCGAGAAACTTGTTGTTGACGATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017432.2-861s1c1
Sequence:CCGGGTCAACAACAAGTTTCTGGCACTCGAGTGCCAGAAACTTGTTGTTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017432.2-722s1c1
Sequence:CCGGGTACTCGTCCAAGAAGAAGATCTCGAGATCTTCTTCTTGGACGAGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017432.2-725s1c1
Sequence:CCGGCTCGTCCAAGAAGAAGATCTTCTCGAGAAGATCTTCTTCTTGGACGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017432.2-737s1c1
Sequence:CCGGGAAGATCTTCATGGGCCTCATCTCGAGATGAGGCCCATGAAGATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017432
VALIDATED
PTOV1 MISSION shRNA Lentiviral Transduction Particles
prostate tumor overexpressed 1
Human
20 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017432.3-788s21c1
Sequence:CCGGGTACTCGTCCAAGAAGAAGATCTCGAGATCTTCTTCTTGGACGAGTACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017432.3-927s21c1
Sequence:CCGGGTCAACAACAAGTTTCTGGCACTCGAGTGCCAGAAACTTGTTGTTGACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017432.3-662s21c1
Sequence:CCGGGTTCCACTTCACCAACAGAGACTCGAGTCTCTGTTGGTGAAGTGGAACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017432.2-728s1c1
Sequence:CCGGGTCCAAGAAGAAGATCTTCATCTCGAGATGAAGATCTTCTTCTTGGACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017432.2-1199s1c1
Sequence:CCGGGCTCCTGTACTCTTCAGAGAACTCGAGTTCTCTGAAGAGTACAGGAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017432.2-518s1c1
Sequence:CCGGGAAGCTGATCATGCAGCTGATCTCGAGATCAGCTGCATGATCAGCTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017432.2-1202s1c1
Sequence:CCGGCCTGTACTCTTCAGAGAAGAACTCGAGTTCTTCTCTGAAGAGTACAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017432.3-491s21c1
Sequence:CCGGCTACTCTGACTCCACTGCAAACTCGAGTTTGCAGTGGAGTCAGAGTAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017432.3-1268s21c1
Sequence:CCGGCCTGTACTCTTCAGAGAAGAACTCGAGTTCTTCTCTGAAGAGTACAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017432.2-1004s1c1
Sequence:CCGGGAAGCTGTACATGCAGCTCATCTCGAGATGAGCTGCATGTACAGCTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017432.2-1165s1c1
Sequence:CCGGCCTACAAAGCATCGTGTGAGACTCGAGTCTCACACGATGCTTTGTAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017432.2-719s1c1
Sequence:CCGGCCTGTACTCGTCCAAGAAGAACTCGAGTTCTTCTTGGACGAGTACAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017432.2-594s1c1
Sequence:CCGGCAGTTCCACTTCACCAACAGACTCGAGTCTGTTGGTGAAGTGGAACTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017432.2-425s1c1
Sequence:CCGGCTACTCTGACTCCACTGCAAACTCGAGTTTGCAGTGGAGTCAGAGTAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017432.2-596s1c1
Sequence:CCGGGTTCCACTTCACCAACAGAGACTCGAGTCTCTGTTGGTGAAGTGGAACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017432.2-855s1c1
Sequence:CCGGCAGATCGTCAACAACAAGTTTCTCGAGAAACTTGTTGTTGACGATCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017432.2-861s1c1
Sequence:CCGGGTCAACAACAAGTTTCTGGCACTCGAGTGCCAGAAACTTGTTGTTGACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017432.2-722s1c1
Sequence:CCGGGTACTCGTCCAAGAAGAAGATCTCGAGATCTTCTTCTTGGACGAGTACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017432.2-725s1c1
Sequence:CCGGCTCGTCCAAGAAGAAGATCTTCTCGAGAAGATCTTCTTCTTGGACGAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017432.2-737s1c1
Sequence:CCGGGAAGATCTTCATGGGCCTCATCTCGAGATGAGGCCCATGAAGATCTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133949
VALIDATED
PTOV1 MISSION shRNA Bacterial Glycerol Stock
prostate tumor overexpressed 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000233370    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133949.1-1642s21c1
Sequence:CCGGACTGCCTCCTGCTACCAATATCTCGAGATATTGGTAGCAGGAGGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133949.1-1240s21c1
Sequence:CCGGGTACAGTTCCACTTCACTAAGCTCGAGCTTAGTGAAGTGGAACTGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133949.1-1283s21c1
Sequence:CCGGTTTGCCGGATCATGGACAATGCTCGAGCATTGTCCATGATCCGGCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133949.1-1004s21c1
Sequence:CCGGACTCTGGACCTGTTCAGATTGCTCGAGCAATCTGAACAGGTCCAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133949.1-596s21c1
Sequence:CCGGACTCCACAGCCAAGCTGAAACCTCGAGGTTTCAGCTTGGCTGTGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133949
VALIDATED
PTOV1 MISSION shRNA shRNA Plasmid DNA
prostate tumor overexpressed 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000233370    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133949.1-1642s21c1
Sequence:CCGGACTGCCTCCTGCTACCAATATCTCGAGATATTGGTAGCAGGAGGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133949.1-1240s21c1
Sequence:CCGGGTACAGTTCCACTTCACTAAGCTCGAGCTTAGTGAAGTGGAACTGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133949.1-1283s21c1
Sequence:CCGGTTTGCCGGATCATGGACAATGCTCGAGCATTGTCCATGATCCGGCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133949.1-1004s21c1
Sequence:CCGGACTCTGGACCTGTTCAGATTGCTCGAGCAATCTGAACAGGTCCAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133949.1-596s21c1
Sequence:CCGGACTCCACAGCCAAGCTGAAACCTCGAGGTTTCAGCTTGGCTGTGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133949
VALIDATED
PTOV1 MISSION shRNA Lentiviral Transduction Particles
prostate tumor overexpressed 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000233370    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133949.1-1642s21c1
Sequence:CCGGACTGCCTCCTGCTACCAATATCTCGAGATATTGGTAGCAGGAGGCAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133949.1-1240s21c1
Sequence:CCGGGTACAGTTCCACTTCACTAAGCTCGAGCTTAGTGAAGTGGAACTGTACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133949.1-1283s21c1
Sequence:CCGGTTTGCCGGATCATGGACAATGCTCGAGCATTGTCCATGATCCGGCAAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133949.1-1004s21c1
Sequence:CCGGACTCTGGACCTGTTCAGATTGCTCGAGCAATCTGAACAGGTCCAGAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133949.1-596s21c1
Sequence:CCGGACTCCACAGCCAAGCTGAAACCTCGAGGTTTCAGCTTGGCTGTGGAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)