EMAIL THIS PAGE TO A FRIEND

PTP4A3

protein tyrosine phosphatase type IVA, member 3

81 Gene Product Result for
Synonyms: PRL-3 PRL-R PRL3
UniProtKB ID: O75365, Q8IVN5, Q99849, Q9BTW5
Gene ID:
Human(11156) Summary: The protein encoded by this gene belongs to a small class of prenylated protein tyrosine phosphatases (PTPs). PTPs are cell signaling molecules that play regulatory roles in a variety of cellular processes. This class of PTPs contain a PTP domain and a characteristic C-terminal prenylation motif. Studies of this class of PTPs in mice demonstrated that they were prenylated proteins in vivo, which suggested their association with cell plasma membrane. Overexpression of this gene in mammalian cells was reported to inhibit angiotensin-II induced cell calcium mobilization and promote cell growth. Two alternatively spliced variants exist. [provided by RefSeq, Jul 2008]
Mouse(19245) protein tyrosine phosphatase 4a3
Rat(362930) protein tyrosine phosphatase type IVA, member 3
Zebrafish(406460) protein tyrosine phosphatase type IVA, member 3
domestic cat(101096639) protein tyrosine phosphatase type IVA, member 3
dog(606961) protein tyrosine phosphatase type IVA, member 3
chicken(768713) protein tyrosine phosphatase type IVA, member 3
naked mole-rat(101706683) protein tyrosine phosphatase type IVA, member 3
domestic guinea pig(100724863) protein tyrosine phosphatase type IVA, member 3
cow(100137722) protein tyrosine phosphatase type IVA, member 3
sheep(101120416) protein tyrosine phosphatase type IVA, member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
P0498 Anti-PRL-3 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB1306065 ANTI-PRL3 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
western blot pricing
SAB1306066 ANTI-PRL3(C-TERMINAL) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2500824 Anti-PRL3/PTP4A3 antibody produced in goat affinity isolated antibody, buffered aqueous solution human, mouse
ELISA, western blot pricing
SAB1105341 Anti-PTP4A3 (111-125) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB1105340 Anti-PTP4A3 (52-65) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
GW22107F Anti-PTP4A3 antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB2701818 Anti-ptp4a3 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
western blot pricing
SAB2101908 Anti-PTP4A3 antibody produced in rabbit affinity isolated antibody mouse, zebrafish, canine, rabbit, horse, guinea pig, bovine, human, rat
western blot pricing
SAB4300569 Anti-PTP4A3 antibody produced in rabbit affinity isolated antibody rat, mouse, human
western blot pricing
SAB1305533 MONOCLONAL ANTI-PRL3 antibody produced in mouse clone 111AT714, IgG fraction of antiserum, buffered aqueous solution mouse, human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007079 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007079 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007079 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008975 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008975 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008975 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU152151 MISSION® esiRNA esiRNA human PTP4A3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007079 Rosetta Predictions human pricing
NM_032611 Rosetta Predictions human pricing
NM_001114405 Rosetta Predictions rat pricing
NM_008975 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007079 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073030 predicted 424
2 SASI_Hs01_00073032 predicted 406
3 SASI_Hs01_00073033 predicted 362
4 SASI_Hs01_00073034 predicted 958
5 SASI_Hs01_00073035 predicted 360
6 SASI_Hs01_00073036 predicted 1009
7 SASI_Hs01_00073039 predicted 925
8 SASI_Hs02_00342908 predicted 411
9 SASI_Hs02_00342909 predicted 355
10 SASI_Hs02_00342910 predicted 1026
11 SASI_Hs01_00073031 predicted 425
12 SASI_Hs01_00073037 predicted 1019
13 SASI_Hs01_00073038 predicted 392
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032611 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025114 predicted 422
2 SASI_Hs01_00025116 predicted 414
3 SASI_Hs01_00025117 predicted 363
4 SASI_Hs01_00025118 predicted 1033
5 SASI_Hs01_00025119 predicted 360
6 SASI_Hs01_00025120 predicted 1083
7 SASI_Hs01_00025123 predicted 998
8 SASI_Hs02_00360168 predicted 413
9 SASI_Hs02_00360169 predicted 357
10 SASI_Hs02_00360170 predicted 1099
11 SASI_Hs01_00025115 predicted 421
12 SASI_Hs01_00025121 predicted 1095
13 SASI_Hs01_00025122 predicted 383
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114405 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252263 predicted 747
2 SASI_Rn02_00252264 predicted 712
3 SASI_Rn02_00252265 predicted 779
4 SASI_Rn02_00252266 predicted 609
5 SASI_Rn02_00252267 predicted 527
6 SASI_Rn02_00252268 predicted 1028
7 SASI_Rn02_00252269 predicted 842
8 SASI_Rn02_00252270 predicted 946
9 SASI_Rn02_00252271 predicted 513
10 SASI_Rn02_00252272 predicted 993
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008975 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00067364 predicted 1274
2 SASI_Mm01_00067365 predicted 1385
3 SASI_Mm01_00067367 predicted 1413
4 SASI_Mm01_00067368 predicted 1422
5 SASI_Mm01_00067369 predicted 1197
6 SASI_Mm01_00067371 predicted 1400
7 SASI_Mm01_00067372 predicted 1351
8 SASI_Mm01_00067373 predicted 1342
9 SASI_Mm02_00315056 predicted 1132
10 SASI_Mm02_00315057 predicted 1077
11 SASI_Mm01_00067366 predicted 1381
12 SASI_Mm01_00067370 predicted 1239
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007079
PTP4A3 MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase type IVA, member 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007079.x-375s1c1
Sequence:CCGGACAAACACATGCGCTTCCTCACTCGAGTGAGGAAGCGCATGTGTTTGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007079.x-524s1c1
Sequence:CCGGACCGTTGTGGACTGGCCGTTTCTCGAGAAACGGCCAGTCCACAACGGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007079.x-472s1c1
Sequence:CCGGGCGTGTGTGTGAAGTGACCTACTCGAGTAGGTCACTTCACACACACGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001884    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007079.x-1181s1c1
Sequence:CCGGTCTCGGCACCTTAAATTATTACTCGAGTAATAATTTAAGGTGCCGAGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007079.x-373s1c1
Sequence:CCGGCTACAAACACATGCGCTTCCTCTCGAGAGGAAGCGCATGTGTTTGTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007079.2-693s21c1
Sequence:CCGGAGCTCACCTACCTGGAGAAATCTCGAGATTTCTCCAGGTAGGTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007079.2-721s21c1
Sequence:CCGGCAAACAGAGGCTGCGGTTCAACTCGAGTTGAACCGCAGCCTCTGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007079.2-757s21c1
Sequence:CCGGCAAGACCCGGTGCTGCGTTATCTCGAGATAACGCAGCACCGGGTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007079.2-476s21c1
Sequence:CCGGGTGTGTGAAGTGACCTATGACCTCGAGGTCATAGGTCACTTCACACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007079
PTP4A3 MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase type IVA, member 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007079.x-375s1c1
Sequence:CCGGACAAACACATGCGCTTCCTCACTCGAGTGAGGAAGCGCATGTGTTTGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007079.x-524s1c1
Sequence:CCGGACCGTTGTGGACTGGCCGTTTCTCGAGAAACGGCCAGTCCACAACGGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007079.x-472s1c1
Sequence:CCGGGCGTGTGTGTGAAGTGACCTACTCGAGTAGGTCACTTCACACACACGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001884    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007079.x-1181s1c1
Sequence:CCGGTCTCGGCACCTTAAATTATTACTCGAGTAATAATTTAAGGTGCCGAGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007079.x-373s1c1
Sequence:CCGGCTACAAACACATGCGCTTCCTCTCGAGAGGAAGCGCATGTGTTTGTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007079.2-693s21c1
Sequence:CCGGAGCTCACCTACCTGGAGAAATCTCGAGATTTCTCCAGGTAGGTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007079.2-721s21c1
Sequence:CCGGCAAACAGAGGCTGCGGTTCAACTCGAGTTGAACCGCAGCCTCTGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007079.2-757s21c1
Sequence:CCGGCAAGACCCGGTGCTGCGTTATCTCGAGATAACGCAGCACCGGGTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007079.2-476s21c1
Sequence:CCGGGTGTGTGAAGTGACCTATGACCTCGAGGTCATAGGTCACTTCACACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007079
PTP4A3 MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase type IVA, member 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007079.x-375s1c1
Sequence:CCGGACAAACACATGCGCTTCCTCACTCGAGTGAGGAAGCGCATGTGTTTGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007079.x-524s1c1
Sequence:CCGGACCGTTGTGGACTGGCCGTTTCTCGAGAAACGGCCAGTCCACAACGGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007079.x-472s1c1
Sequence:CCGGGCGTGTGTGTGAAGTGACCTACTCGAGTAGGTCACTTCACACACACGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001884    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007079.x-1181s1c1
Sequence:CCGGTCTCGGCACCTTAAATTATTACTCGAGTAATAATTTAAGGTGCCGAGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007079.x-373s1c1
Sequence:CCGGCTACAAACACATGCGCTTCCTCTCGAGAGGAAGCGCATGTGTTTGTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007079.2-693s21c1
Sequence:CCGGAGCTCACCTACCTGGAGAAATCTCGAGATTTCTCCAGGTAGGTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007079.2-721s21c1
Sequence:CCGGCAAACAGAGGCTGCGGTTCAACTCGAGTTGAACCGCAGCCTCTGTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007079.2-757s21c1
Sequence:CCGGCAAGACCCGGTGCTGCGTTATCTCGAGATAACGCAGCACCGGGTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007079.2-476s21c1
Sequence:CCGGGTGTGTGAAGTGACCTATGACCTCGAGGTCATAGGTCACTTCACACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008975
PTP4A3 MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase type IVA, member 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008975.2-987s1c1
Sequence:CCGGCGCGTGTGTGAAGTGACCTATCTCGAGATAGGTCACTTCACACACGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008975.2-1120s1c1
Sequence:CCGGAGTTCTACAATGACCCGGGAACTCGAGTTCCCGGGTCATTGTAGAACTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008975.2-1235s1c1
Sequence:CCGGCATCCAGTTCATCCGACAGAACTCGAGTTCTGTCGGATGAACTGGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008975.2-899s1c1
Sequence:CCGGGCGCTTCCTCATCACCCACAACTCGAGTTGTGGGTGATGAGGAAGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029869    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008975.2-3004s1c1
Sequence:CCGGCGGCCCAAAGATTTATTTATTCTCGAGAATAAATAAATCTTTGGGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008975.2-1235s21c1
Sequence:CCGGCATCCAGTTCATCCGACAGAACTCGAGTTCTGTCGGATGAACTGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008975.2-899s21c1
Sequence:CCGGGCGCTTCCTCATCACCCACAACTCGAGTTGTGGGTGATGAGGAAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319973    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008975.2-3004s21c1
Sequence:CCGGCGGCCCAAAGATTTATTTATTCTCGAGAATAAATAAATCTTTGGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008975.2-987s21c1
Sequence:CCGGCGCGTGTGTGAAGTGACCTATCTCGAGATAGGTCACTTCACACACGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008975
PTP4A3 MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase type IVA, member 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008975.2-987s1c1
Sequence:CCGGCGCGTGTGTGAAGTGACCTATCTCGAGATAGGTCACTTCACACACGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008975.2-1120s1c1
Sequence:CCGGAGTTCTACAATGACCCGGGAACTCGAGTTCCCGGGTCATTGTAGAACTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008975.2-1235s1c1
Sequence:CCGGCATCCAGTTCATCCGACAGAACTCGAGTTCTGTCGGATGAACTGGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008975.2-899s1c1
Sequence:CCGGGCGCTTCCTCATCACCCACAACTCGAGTTGTGGGTGATGAGGAAGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029869    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008975.2-3004s1c1
Sequence:CCGGCGGCCCAAAGATTTATTTATTCTCGAGAATAAATAAATCTTTGGGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008975.2-1235s21c1
Sequence:CCGGCATCCAGTTCATCCGACAGAACTCGAGTTCTGTCGGATGAACTGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008975.2-899s21c1
Sequence:CCGGGCGCTTCCTCATCACCCACAACTCGAGTTGTGGGTGATGAGGAAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319973    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008975.2-3004s21c1
Sequence:CCGGCGGCCCAAAGATTTATTTATTCTCGAGAATAAATAAATCTTTGGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008975.2-987s21c1
Sequence:CCGGCGCGTGTGTGAAGTGACCTATCTCGAGATAGGTCACTTCACACACGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008975
PTP4A3 MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase type IVA, member 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008975.2-987s1c1
Sequence:CCGGCGCGTGTGTGAAGTGACCTATCTCGAGATAGGTCACTTCACACACGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008975.2-1120s1c1
Sequence:CCGGAGTTCTACAATGACCCGGGAACTCGAGTTCCCGGGTCATTGTAGAACTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008975.2-1235s1c1
Sequence:CCGGCATCCAGTTCATCCGACAGAACTCGAGTTCTGTCGGATGAACTGGATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008975.2-899s1c1
Sequence:CCGGGCGCTTCCTCATCACCCACAACTCGAGTTGTGGGTGATGAGGAAGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029869    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008975.2-3004s1c1
Sequence:CCGGCGGCCCAAAGATTTATTTATTCTCGAGAATAAATAAATCTTTGGGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008975.2-1235s21c1
Sequence:CCGGCATCCAGTTCATCCGACAGAACTCGAGTTCTGTCGGATGAACTGGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008975.2-899s21c1
Sequence:CCGGGCGCTTCCTCATCACCCACAACTCGAGTTGTGGGTGATGAGGAAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319973    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008975.2-3004s21c1
Sequence:CCGGCGGCCCAAAGATTTATTTATTCTCGAGAATAAATAAATCTTTGGGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008975.2-987s21c1
Sequence:CCGGCGCGTGTGTGAAGTGACCTATCTCGAGATAGGTCACTTCACACACGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)