EMAIL THIS PAGE TO A FRIEND

PTPLA

protein tyrosine phosphatase-like (proline instead of catalytic arginine), member A

82 Gene Product Result for
Synonyms: CAP HACD1
UniProtKB ID: B0YJ81, B0YJ80, Q6JIC5, Q96FW7, Q9HB93, Q9UHX2
Gene ID:
Human(9200) Summary: The protein encoded by this gene contains a characteristic catalytic motif of the protein tyrosine phosphatases (PTPs) family. The PTP motif of this protein has the highly conserved arginine residue replaced by a proline residue; thus it may represent a distinct class of PTPs. Members of the PTP family are known to be signaling molecules that regulate a variety of cellular processes. This gene was preferentially expressed in both adult and fetal heart. A much lower expression level was detected in skeletal and smooth muscle tissues, and no expression was observed in other tissues. The tissue specific expression in the developing and adult heart suggests a role in regulating cardiac development and differentiation. [provided by RefSeq, Jul 2008]
Mouse(30963) protein tyrosine phosphatase-like (proline instead of catalytic arginine), member a
Rat(680115) protein tyrosine phosphatase-like (proline instead of catalytic arginine), member a
naked mole-rat(101718268) protein tyrosine phosphatase-like (proline instead of catalytic arginine), member A
domestic guinea pig(100723879) protein tyrosine phosphatase-like (proline instead of catalytic arginine), member A
cow(615191) protein tyrosine phosphatase-like (proline instead of catalytic arginine), member A
sheep(443484) protein tyrosine phosphatase-like (proline instead of catalytic arginine), member A
chicken(420518) protein tyrosine phosphatase-like (proline instead of catalytic arginine), member A
domestic cat(101092752) protein tyrosine phosphatase-like (proline instead of catalytic arginine), member A
dog(574011) protein tyrosine phosphatase-like (proline instead of catalytic arginine), member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302650 ANTI-PTPLA (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013935 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013935 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013935 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014241 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014241 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014241 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU061291 MISSION® esiRNA esiRNA human PTPLA (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014241 siRNAs that have been validated in the lab human pricing
NM_001101001 Rosetta Predictions rat pricing
NM_001012396 Rosetta Predictions mouse pricing
NM_013935 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014241 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105498 validated 493
2 SASI_Hs01_00105495 predicted 576
3 SASI_Hs01_00105497 predicted 405
4 SASI_Hs01_00105499 predicted 732
5 SASI_Hs01_00105500 predicted 386
6 SASI_Hs01_00105501 predicted 680
7 SASI_Hs01_00105502 predicted 647
8 SASI_Hs01_00105503 predicted 469
9 SASI_Hs01_00105504 predicted 263
10 SASI_Hs02_00345282 predicted 655
11 SASI_Hs01_00105496 predicted 900
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001101001 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211136 predicted 527
2 SASI_Rn02_00211137 predicted 274
3 SASI_Rn02_00211138 predicted 610
4 SASI_Rn02_00211139 predicted 419
5 SASI_Rn02_00211140 predicted 242
6 SASI_Rn02_00211141 predicted 392
7 SASI_Rn02_00211142 predicted 512
8 SASI_Rn02_00211143 predicted 329
9 SASI_Rn02_00211144 predicted 347
10 SASI_Rn02_00211145 predicted 556
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012396 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139999 predicted 236
2 SASI_Mm02_00287104 predicted 241
3 SASI_Mm01_00140001 predicted 235
4 SASI_Mm01_00140002 predicted 225
5 SASI_Mm01_00140003 predicted 231
6 SASI_Mm01_00140004 predicted 194
7 SASI_Mm01_00140005 predicted 291
8 SASI_Mm01_00140007 predicted 288
9 SASI_Mm02_00287105 predicted 254
10 SASI_Mm01_00140008 predicted 297
11 SASI_Mm01_00140000 predicted 308
12 SASI_Mm01_00140006 predicted 304
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013935 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123422 predicted 236
2 SASI_Mm02_00323037 predicted 242
3 SASI_Mm01_00123424 predicted 230
4 SASI_Mm01_00123425 predicted 218
5 SASI_Mm01_00123426 predicted 229
6 SASI_Mm01_00123427 predicted 193
7 SASI_Mm01_00123428 predicted 298
8 SASI_Mm01_00123430 predicted 287
9 SASI_Mm02_00323038 predicted 261
10 SASI_Mm01_00123431 predicted 296
11 SASI_Mm01_00123423 predicted 300
12 SASI_Mm01_00123429 predicted 303
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013935
PTPLA MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase-like (proline instead of catalytic arginine), member A
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013935.1-683s1c1
Sequence:CCGGCTTCATTAAATGGGCCAGATACTCGAGTATCTGGCCCATTTAATGAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013935.3-716s21c1
Sequence:CCGGCCGCCTTGCCTTACGTAAAGACTCGAGTCTTTACGTAAGGCAAGGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013935.1-864s1c1
Sequence:CCGGGCCTCCTATATACCGTTGTTTCTCGAGAAACAACGGTATATAGGAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013935.1-366s1c1
Sequence:CCGGGCTATTGCTATGGTACGCTTTCTCGAGAAAGCGTACCATAGCAATAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013935.1-459s1c1
Sequence:CCGGGCTTTGCTTGAGGTAGTCCATCTCGAGATGGACTACCTCAAGCAAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013935.1-804s1c1
Sequence:CCGGCGGCTTCCCAACAAGTACAATCTCGAGATTGTACTTGTTGGGAAGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013935.3-507s21c1
Sequence:CCGGGCTCATTACTCACAGTATAAACTCGAGTTTATACTGTGAGTAATGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013935
PTPLA MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase-like (proline instead of catalytic arginine), member A
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013935.1-683s1c1
Sequence:CCGGCTTCATTAAATGGGCCAGATACTCGAGTATCTGGCCCATTTAATGAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013935.3-716s21c1
Sequence:CCGGCCGCCTTGCCTTACGTAAAGACTCGAGTCTTTACGTAAGGCAAGGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013935.1-864s1c1
Sequence:CCGGGCCTCCTATATACCGTTGTTTCTCGAGAAACAACGGTATATAGGAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013935.1-366s1c1
Sequence:CCGGGCTATTGCTATGGTACGCTTTCTCGAGAAAGCGTACCATAGCAATAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013935.1-459s1c1
Sequence:CCGGGCTTTGCTTGAGGTAGTCCATCTCGAGATGGACTACCTCAAGCAAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013935.1-804s1c1
Sequence:CCGGCGGCTTCCCAACAAGTACAATCTCGAGATTGTACTTGTTGGGAAGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013935.3-507s21c1
Sequence:CCGGGCTCATTACTCACAGTATAAACTCGAGTTTATACTGTGAGTAATGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013935
PTPLA MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase-like (proline instead of catalytic arginine), member A
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013935.1-683s1c1
Sequence:CCGGCTTCATTAAATGGGCCAGATACTCGAGTATCTGGCCCATTTAATGAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013935.3-716s21c1
Sequence:CCGGCCGCCTTGCCTTACGTAAAGACTCGAGTCTTTACGTAAGGCAAGGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013935.1-864s1c1
Sequence:CCGGGCCTCCTATATACCGTTGTTTCTCGAGAAACAACGGTATATAGGAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013935.1-366s1c1
Sequence:CCGGGCTATTGCTATGGTACGCTTTCTCGAGAAAGCGTACCATAGCAATAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013935.1-459s1c1
Sequence:CCGGGCTTTGCTTGAGGTAGTCCATCTCGAGATGGACTACCTCAAGCAAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013935.1-804s1c1
Sequence:CCGGCGGCTTCCCAACAAGTACAATCTCGAGATTGTACTTGTTGGGAAGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013935.3-507s21c1
Sequence:CCGGGCTCATTACTCACAGTATAAACTCGAGTTTATACTGTGAGTAATGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014241
VALIDATED
PTPLA MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase-like (proline instead of catalytic arginine), member A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_014241.x-579s1c1
Sequence:CCGGTCGCTATTCCTTCTACACATTCTCGAGAATGTGTAGAAGGAATAGCGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003008    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_014241.x-939s1c1
Sequence:CCGGACCAAGATTACCTGAGTCCAACTCGAGTTGGACTCAGGTAATCTTGGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014241.x-394s1c1
Sequence:CCGGACATTTGCCTTGCTTGAGATACTCGAGTATCTCAAGCAAGGCAAATGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014241.x-612s1c1
Sequence:CCGGCCACTTGCCATACTTCATTAACTCGAGTTAATGAAGTATGGCAAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014241.x-602s1c1
Sequence:CCGGGCCTTCTTGACCACTTGCCATCTCGAGATGGCAAGTGGTCAAGAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_014241.3-794s21c1
Sequence:CCGGTATAACCATGGCATCATATATCTCGAGATATATGATGCCATGGTTATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_014241.3-611s21c1
Sequence:CCGGCCACTTGCCATACTTCATTAACTCGAGTTAATGAAGTATGGCAAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_014241.3-578s21c1
Sequence:CCGGTCGCTATTCCTTCTACACATTCTCGAGAATGTGTAGAAGGAATAGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014241.3-393s21c1
Sequence:CCGGACATTTGCCTTGCTTGAGATACTCGAGTATCTCAAGCAAGGCAAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273187    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014241.3-1032s21c1
Sequence:CCGGACGTGGTATTTGCCAGTATTTCTCGAGAAATACTGGCAAATACCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014241
VALIDATED
PTPLA MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase-like (proline instead of catalytic arginine), member A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_014241.x-579s1c1
Sequence:CCGGTCGCTATTCCTTCTACACATTCTCGAGAATGTGTAGAAGGAATAGCGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003008    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_014241.x-939s1c1
Sequence:CCGGACCAAGATTACCTGAGTCCAACTCGAGTTGGACTCAGGTAATCTTGGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014241.x-394s1c1
Sequence:CCGGACATTTGCCTTGCTTGAGATACTCGAGTATCTCAAGCAAGGCAAATGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014241.x-612s1c1
Sequence:CCGGCCACTTGCCATACTTCATTAACTCGAGTTAATGAAGTATGGCAAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014241.x-602s1c1
Sequence:CCGGGCCTTCTTGACCACTTGCCATCTCGAGATGGCAAGTGGTCAAGAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_014241.3-794s21c1
Sequence:CCGGTATAACCATGGCATCATATATCTCGAGATATATGATGCCATGGTTATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_014241.3-611s21c1
Sequence:CCGGCCACTTGCCATACTTCATTAACTCGAGTTAATGAAGTATGGCAAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_014241.3-578s21c1
Sequence:CCGGTCGCTATTCCTTCTACACATTCTCGAGAATGTGTAGAAGGAATAGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014241.3-393s21c1
Sequence:CCGGACATTTGCCTTGCTTGAGATACTCGAGTATCTCAAGCAAGGCAAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273187    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014241.3-1032s21c1
Sequence:CCGGACGTGGTATTTGCCAGTATTTCTCGAGAAATACTGGCAAATACCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014241
VALIDATED
PTPLA MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase-like (proline instead of catalytic arginine), member A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_014241.x-579s1c1
Sequence:CCGGTCGCTATTCCTTCTACACATTCTCGAGAATGTGTAGAAGGAATAGCGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003008    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_014241.x-939s1c1
Sequence:CCGGACCAAGATTACCTGAGTCCAACTCGAGTTGGACTCAGGTAATCTTGGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014241.x-394s1c1
Sequence:CCGGACATTTGCCTTGCTTGAGATACTCGAGTATCTCAAGCAAGGCAAATGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014241.x-612s1c1
Sequence:CCGGCCACTTGCCATACTTCATTAACTCGAGTTAATGAAGTATGGCAAGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014241.x-602s1c1
Sequence:CCGGGCCTTCTTGACCACTTGCCATCTCGAGATGGCAAGTGGTCAAGAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_014241.3-794s21c1
Sequence:CCGGTATAACCATGGCATCATATATCTCGAGATATATGATGCCATGGTTATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_014241.3-611s21c1
Sequence:CCGGCCACTTGCCATACTTCATTAACTCGAGTTAATGAAGTATGGCAAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_014241.3-578s21c1
Sequence:CCGGTCGCTATTCCTTCTACACATTCTCGAGAATGTGTAGAAGGAATAGCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014241.3-393s21c1
Sequence:CCGGACATTTGCCTTGCTTGAGATACTCGAGTATCTCAAGCAAGGCAAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273187    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014241.3-1032s21c1
Sequence:CCGGACGTGGTATTTGCCAGTATTTCTCGAGAAATACTGGCAAATACCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)