EMAIL THIS PAGE TO A FRIEND

PTPLAD1

protein tyrosine phosphatase-like A domain containing 1

67 Gene Product Result for
Synonyms: B-IND1 HACD3 HSPC121
Gene ID:
Mouse(57874) protein tyrosine phosphatase-like A domain containing 1
Rat(300783) protein tyrosine phosphatase-like A domain containing 1
Zebrafish(393441) protein tyrosine phosphatase-like A domain containing 1
domestic cat(101084111) protein tyrosine phosphatase-like A domain containing 1
dog(478345) protein tyrosine phosphatase-like A domain containing 1
chicken(415539) protein tyrosine phosphatase-like A domain containing 1
cow(100125237) protein tyrosine phosphatase-like A domain containing 1
sheep(101120835) protein tyrosine phosphatase-like A domain containing 1
domestic guinea pig(100714636) protein tyrosine phosphatase-like A domain containing 1
naked mole-rat(101719524) protein tyrosine phosphatase-like A domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016395 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016395 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016395 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021345 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021345 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021345 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016395 Rosetta Predictions human pricing
NM_001106831 Rosetta Predictions rat pricing
NM_021345 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016395 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349396 predicted 618
2 SASI_Hs02_00349397 predicted 584
3 SASI_Hs02_00349398 predicted 568
4 SASI_Hs02_00349399 predicted 478
5 SASI_Hs01_00050008 predicted 290
6 SASI_Hs02_00349400 predicted 694
7 SASI_Hs02_00349401 predicted 860
8 SASI_Hs02_00349402 predicted 959
9 SASI_Hs02_00349403 predicted 650
10 SASI_Hs01_00050011 predicted 490
11 SASI_Hs01_00050004 predicted 516
12 SASI_Hs01_00050005 predicted 513
13 SASI_Hs01_00050006 predicted 384
14 SASI_Hs01_00050007 predicted 273
15 SASI_Hs01_00050009 predicted 305
16 SASI_Hs01_00050010 predicted 384
17 SASI_Hs01_00050012 predicted 358
18 SASI_Hs01_00050013 predicted 472
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106831 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222838 predicted 792
2 SASI_Rn02_00222839 predicted 972
3 SASI_Rn02_00222840 predicted 641
4 SASI_Rn02_00222841 predicted 622
5 SASI_Rn02_00222842 predicted 480
6 SASI_Rn02_00222843 predicted 423
7 SASI_Rn02_00222844 predicted 343
8 SASI_Rn02_00222845 predicted 347
9 SASI_Rn02_00222846 predicted 991
10 SASI_Rn02_00222847 predicted 1033
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021345 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00160962 predicted 672
2 SASI_Mm01_00160963 predicted 758
3 SASI_Mm01_00160964 predicted 944
4 SASI_Mm01_00160965 predicted 607
5 SASI_Mm01_00160967 predicted 1063
6 SASI_Mm01_00160969 predicted 1066
7 SASI_Mm01_00160970 predicted 403
8 SASI_Mm01_00160971 predicted 929
9 SASI_Mm02_00325926 predicted 1067
10 SASI_Mm02_00325927 predicted 309
11 SASI_Mm01_00160966 predicted 994
12 SASI_Mm01_00160968 predicted 952
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016395
VALIDATED
PTPLAD1 MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase-like A domain containing 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016395.2-1039s21c1
Sequence:CCGGGATTCAGTCCATTCCAATATTCTCGAGAATATTGGAATGGACTGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016395.1-1070s1c2
Sequence:CCGGCGGACGATTCAGTTTCACATTCTCGAGAATGTGAAACTGAATCGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416293    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016395.2-1640s21c1
Sequence:CCGGACTCTATAGAAGGCTGTTAAACTCGAGTTTAACAGCCTTCTATAGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016395.1-559s1c1
Sequence:CCGGGCTCTCCTGAAACTCTTACAACTCGAGTTGTAAGAGTTTCAGGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072998    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016395.1-1369s1c1
Sequence:CCGGCCCAGTAACATTCCTGAATTTCTCGAGAAATTCAGGAATGTTACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016395.1-741s1c1
Sequence:CCGGGCAGTTGTGGAAACTATCAATCTCGAGATTGATAGTTTCCACAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016395.1-977s1c1
Sequence:CCGGGCTTCGTTACACTCTGTGGATCTCGAGATCCACAGAGTGTAACGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016395
VALIDATED
PTPLAD1 MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase-like A domain containing 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016395.2-1039s21c1
Sequence:CCGGGATTCAGTCCATTCCAATATTCTCGAGAATATTGGAATGGACTGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016395.1-1070s1c2
Sequence:CCGGCGGACGATTCAGTTTCACATTCTCGAGAATGTGAAACTGAATCGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416293    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016395.2-1640s21c1
Sequence:CCGGACTCTATAGAAGGCTGTTAAACTCGAGTTTAACAGCCTTCTATAGAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016395.1-559s1c1
Sequence:CCGGGCTCTCCTGAAACTCTTACAACTCGAGTTGTAAGAGTTTCAGGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072998    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016395.1-1369s1c1
Sequence:CCGGCCCAGTAACATTCCTGAATTTCTCGAGAAATTCAGGAATGTTACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016395.1-741s1c1
Sequence:CCGGGCAGTTGTGGAAACTATCAATCTCGAGATTGATAGTTTCCACAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016395.1-977s1c1
Sequence:CCGGGCTTCGTTACACTCTGTGGATCTCGAGATCCACAGAGTGTAACGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016395
VALIDATED
PTPLAD1 MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase-like A domain containing 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016395.2-1039s21c1
Sequence:CCGGGATTCAGTCCATTCCAATATTCTCGAGAATATTGGAATGGACTGAATCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000222560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016395.1-1070s1c2
Sequence:CCGGCGGACGATTCAGTTTCACATTCTCGAGAATGTGAAACTGAATCGTCCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000416293    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016395.2-1640s21c1
Sequence:CCGGACTCTATAGAAGGCTGTTAAACTCGAGTTTAACAGCCTTCTATAGAGTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000073002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016395.1-559s1c1
Sequence:CCGGGCTCTCCTGAAACTCTTACAACTCGAGTTGTAAGAGTTTCAGGAGAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000072998    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016395.1-1369s1c1
Sequence:CCGGCCCAGTAACATTCCTGAATTTCTCGAGAAATTCAGGAATGTTACTGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000073001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016395.1-741s1c1
Sequence:CCGGGCAGTTGTGGAAACTATCAATCTCGAGATTGATAGTTTCCACAACTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000073000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016395.1-977s1c1
Sequence:CCGGGCTTCGTTACACTCTGTGGATCTCGAGATCCACAGAGTGTAACGAAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021345
PTPLAD1 MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase-like A domain containing 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000320262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021345.2-1155s21c1
Sequence:CCGGCCTTCAAGTTTATCTCGTAATCTCGAGATTACGAGATAAACTTGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021345.2-553s21c1
Sequence:CCGGCGCCTAAATAAACTCAGACTACTCGAGTAGTCTGAGTTTATTTAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021345.2-1002s21c1
Sequence:CCGGGCTCCGTTACACTATGTGGATCTCGAGATCCACATAGTGTAACGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021345.2-872s21c1
Sequence:CCGGGCACCATGGAAGAAATGCAAACTCGAGTTTGCATTTCTTCCATGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021345.1-1052s1c1
Sequence:CCGGCCAGTCCATTCCAGTATTCAACTCGAGTTGAATACTGGAATGGACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021345.1-537s1c1
Sequence:CCGGCGCCTAAATAAACTCAGACTACTCGAGTAGTCTGAGTTTATTTAGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021345.1-856s1c1
Sequence:CCGGGCACCATGGAAGAAATGCAAACTCGAGTTTGCATTTCTTCCATGGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021345.1-1139s1c1
Sequence:CCGGCCTTCAAGTTTATCTCGTAATCTCGAGATTACGAGATAAACTTGAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021345.1-986s1c1
Sequence:CCGGGCTCCGTTACACTATGTGGATCTCGAGATCCACATAGTGTAACGGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021345
PTPLAD1 MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase-like A domain containing 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000320262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021345.2-1155s21c1
Sequence:CCGGCCTTCAAGTTTATCTCGTAATCTCGAGATTACGAGATAAACTTGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021345.2-553s21c1
Sequence:CCGGCGCCTAAATAAACTCAGACTACTCGAGTAGTCTGAGTTTATTTAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021345.2-1002s21c1
Sequence:CCGGGCTCCGTTACACTATGTGGATCTCGAGATCCACATAGTGTAACGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021345.2-872s21c1
Sequence:CCGGGCACCATGGAAGAAATGCAAACTCGAGTTTGCATTTCTTCCATGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021345.1-1052s1c1
Sequence:CCGGCCAGTCCATTCCAGTATTCAACTCGAGTTGAATACTGGAATGGACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021345.1-537s1c1
Sequence:CCGGCGCCTAAATAAACTCAGACTACTCGAGTAGTCTGAGTTTATTTAGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021345.1-856s1c1
Sequence:CCGGGCACCATGGAAGAAATGCAAACTCGAGTTTGCATTTCTTCCATGGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021345.1-1139s1c1
Sequence:CCGGCCTTCAAGTTTATCTCGTAATCTCGAGATTACGAGATAAACTTGAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021345.1-986s1c1
Sequence:CCGGGCTCCGTTACACTATGTGGATCTCGAGATCCACATAGTGTAACGGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021345
PTPLAD1 MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase-like A domain containing 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000320262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021345.2-1155s21c1
Sequence:CCGGCCTTCAAGTTTATCTCGTAATCTCGAGATTACGAGATAAACTTGAAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000320261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021345.2-553s21c1
Sequence:CCGGCGCCTAAATAAACTCAGACTACTCGAGTAGTCTGAGTTTATTTAGGCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000320337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021345.2-1002s21c1
Sequence:CCGGGCTCCGTTACACTATGTGGATCTCGAGATCCACATAGTGTAACGGAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000320336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021345.2-872s21c1
Sequence:CCGGGCACCATGGAAGAAATGCAAACTCGAGTTTGCATTTCTTCCATGGTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000030062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021345.1-1052s1c1
Sequence:CCGGCCAGTCCATTCCAGTATTCAACTCGAGTTGAATACTGGAATGGACTGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000030060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021345.1-537s1c1
Sequence:CCGGCGCCTAAATAAACTCAGACTACTCGAGTAGTCTGAGTTTATTTAGGCGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000030063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021345.1-856s1c1
Sequence:CCGGGCACCATGGAAGAAATGCAAACTCGAGTTTGCATTTCTTCCATGGTGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000030061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021345.1-1139s1c1
Sequence:CCGGCCTTCAAGTTTATCTCGTAATCTCGAGATTACGAGATAAACTTGAAGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000030059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021345.1-986s1c1
Sequence:CCGGGCTCCGTTACACTATGTGGATCTCGAGATCCACATAGTGTAACGGAGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???