EMAIL THIS PAGE TO A FRIEND

PTPLAD2

protein tyrosine phosphatase-like A domain containing 2

57 Gene Product Result for
Synonyms: HACD4
UniProtKB ID: Q5VWC8, Q7Z385
Gene ID:
Mouse(66775) protein tyrosine phosphatase-like A domain containing 2
Rat(362540) protein tyrosine phosphatase-like A domain containing 2
naked mole-rat(101698416) protein tyrosine phosphatase-like A domain containing 2
domestic guinea pig(100713755) protein tyrosine phosphatase-like A domain containing 2
cow(618814) protein tyrosine phosphatase-like A domain containing 2
sheep(101102210) protein tyrosine phosphatase-like A domain containing 2
chicken(427232) protein tyrosine phosphatase-like A domain containing 2
dog(611337) protein tyrosine phosphatase-like A domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_376819 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_376819 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_376819 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025760 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025760 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025760 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001010915 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001010915 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001010915 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU030091 MISSION® esiRNA esiRNA targeting mouse Ptplad2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010915 Rosetta Predictions human pricing
NM_001108669 Rosetta Predictions rat pricing
NM_025760 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010915 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141732 predicted 227
2 SASI_Hs01_00141733 predicted 399
3 SASI_Hs01_00141734 predicted 351
4 SASI_Hs01_00141735 predicted 432
5 SASI_Hs01_00141736 predicted 996
6 SASI_Hs01_00141737 predicted 495
7 SASI_Hs01_00141738 predicted 1048
8 SASI_Hs01_00141740 predicted 984
9 SASI_Hs02_00305898 predicted 247
10 SASI_Hs02_00305899 predicted 993
11 SASI_Hs01_00141739 predicted 282
12 SASI_Hs01_00141741 predicted 378
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108669 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240905 predicted 496
2 SASI_Rn02_00240906 predicted 765
3 SASI_Rn02_00240907 predicted 627
4 SASI_Rn02_00240908 predicted 241
5 SASI_Rn02_00240909 predicted 415
6 SASI_Rn02_00240910 predicted 260
7 SASI_Rn02_00240911 predicted 259
8 SASI_Rn02_00240912 predicted 782
9 SASI_Rn02_00240913 predicted 416
10 SASI_Rn02_00240914 predicted 354
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025760 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00049182 predicted 437
2 SASI_Mm01_00049183 predicted 316
3 SASI_Mm01_00049184 predicted 1074
4 SASI_Mm01_00049185 predicted 1195
5 SASI_Mm01_00049186 predicted 415
6 SASI_Mm01_00049187 predicted 418
7 SASI_Mm01_00049188 predicted 1069
8 SASI_Mm01_00049189 predicted 444
9 SASI_Mm01_00049190 predicted 349
10 SASI_Mm01_00049191 predicted 590
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_376819
VALIDATED
PTPLAD2 MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase-like A domain containing 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_376819.2-888s1c1
Sequence:CCGGCCTCGGAATCTTTCCCATTAACTCGAGTTAATGGGAAAGATTCCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_376819.2-418s1c1
Sequence:CCGGCAATCCGTATCTCTCCTGGAACTCGAGTTCCAGGAGAGATACGGATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082713    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_376819.2-2290s1c1
Sequence:CCGGGCCTGTTGAAACCAAGGCAATCTCGAGATTGCCTTGGTTTCAACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376819.2-778s1c1
Sequence:CCGGCCCTTTGACTTATCCATCTATCTCGAGATAGATGGATAAGTCAAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_376819.2-586s1c1
Sequence:CCGGTGGAATCTATTGGATATGGTTCTCGAGAACCATATCCAATAGATTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_376819
VALIDATED
PTPLAD2 MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase-like A domain containing 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_376819.2-888s1c1
Sequence:CCGGCCTCGGAATCTTTCCCATTAACTCGAGTTAATGGGAAAGATTCCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_376819.2-418s1c1
Sequence:CCGGCAATCCGTATCTCTCCTGGAACTCGAGTTCCAGGAGAGATACGGATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082713    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_376819.2-2290s1c1
Sequence:CCGGGCCTGTTGAAACCAAGGCAATCTCGAGATTGCCTTGGTTTCAACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376819.2-778s1c1
Sequence:CCGGCCCTTTGACTTATCCATCTATCTCGAGATAGATGGATAAGTCAAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_376819.2-586s1c1
Sequence:CCGGTGGAATCTATTGGATATGGTTCTCGAGAACCATATCCAATAGATTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_376819
VALIDATED
PTPLAD2 MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase-like A domain containing 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_376819.2-888s1c1
Sequence:CCGGCCTCGGAATCTTTCCCATTAACTCGAGTTAATGGGAAAGATTCCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_376819.2-418s1c1
Sequence:CCGGCAATCCGTATCTCTCCTGGAACTCGAGTTCCAGGAGAGATACGGATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082713    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_376819.2-2290s1c1
Sequence:CCGGGCCTGTTGAAACCAAGGCAATCTCGAGATTGCCTTGGTTTCAACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376819.2-778s1c1
Sequence:CCGGCCCTTTGACTTATCCATCTATCTCGAGATAGATGGATAAGTCAAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_376819.2-586s1c1
Sequence:CCGGTGGAATCTATTGGATATGGTTCTCGAGAACCATATCCAATAGATTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025760
VALIDATED
PTPLAD2 MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase-like A domain containing 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025760.2-685s1c1
Sequence:CCGGGCCATCTTTATACAGAAAGAACTCGAGTTCTTTCTGTATAAAGATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025760.2-534s1c1
Sequence:CCGGGCTGAAGCATTCACCATCTATCTCGAGATAGATGGTGAATGCTTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025760.2-140s1c1
Sequence:CCGGCCACTCATGGATACTGGCAAACTCGAGTTTGCCAGTATCCATGAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025760.2-611s1c1
Sequence:CCGGCCTATCTACCTGTTTCCCTTACTCGAGTAAGGGAAACAGGTAGATAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025760.2-84s1c1
Sequence:CCGGCCCAGGTATAGGAAGAATGTACTCGAGTACATTCTTCCTATACCTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025760.4-90s21c1
Sequence:CCGGCCCAGGTATAGGAAGAATGTACTCGAGTACATTCTTCCTATACCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025760.4-617s21c1
Sequence:CCGGCCTATCTACCTGTTTCCCTTACTCGAGTAAGGGAAACAGGTAGATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025760.4-691s21c1
Sequence:CCGGGCCATCTTTATACAGAAAGAACTCGAGTTCTTTCTGTATAAAGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025760.4-540s21c1
Sequence:CCGGGCTGAAGCATTCACCATCTATCTCGAGATAGATGGTGAATGCTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025760
VALIDATED
PTPLAD2 MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase-like A domain containing 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025760.2-685s1c1
Sequence:CCGGGCCATCTTTATACAGAAAGAACTCGAGTTCTTTCTGTATAAAGATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025760.2-534s1c1
Sequence:CCGGGCTGAAGCATTCACCATCTATCTCGAGATAGATGGTGAATGCTTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025760.2-140s1c1
Sequence:CCGGCCACTCATGGATACTGGCAAACTCGAGTTTGCCAGTATCCATGAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025760.2-611s1c1
Sequence:CCGGCCTATCTACCTGTTTCCCTTACTCGAGTAAGGGAAACAGGTAGATAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025760.2-84s1c1
Sequence:CCGGCCCAGGTATAGGAAGAATGTACTCGAGTACATTCTTCCTATACCTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025760.4-90s21c1
Sequence:CCGGCCCAGGTATAGGAAGAATGTACTCGAGTACATTCTTCCTATACCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025760.4-617s21c1
Sequence:CCGGCCTATCTACCTGTTTCCCTTACTCGAGTAAGGGAAACAGGTAGATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025760.4-691s21c1
Sequence:CCGGGCCATCTTTATACAGAAAGAACTCGAGTTCTTTCTGTATAAAGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025760.4-540s21c1
Sequence:CCGGGCTGAAGCATTCACCATCTATCTCGAGATAGATGGTGAATGCTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025760
VALIDATED
PTPLAD2 MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase-like A domain containing 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025760.2-685s1c1
Sequence:CCGGGCCATCTTTATACAGAAAGAACTCGAGTTCTTTCTGTATAAAGATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025760.2-534s1c1
Sequence:CCGGGCTGAAGCATTCACCATCTATCTCGAGATAGATGGTGAATGCTTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025760.2-140s1c1
Sequence:CCGGCCACTCATGGATACTGGCAAACTCGAGTTTGCCAGTATCCATGAGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025760.2-611s1c1
Sequence:CCGGCCTATCTACCTGTTTCCCTTACTCGAGTAAGGGAAACAGGTAGATAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025760.2-84s1c1
Sequence:CCGGCCCAGGTATAGGAAGAATGTACTCGAGTACATTCTTCCTATACCTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025760.4-90s21c1
Sequence:CCGGCCCAGGTATAGGAAGAATGTACTCGAGTACATTCTTCCTATACCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025760.4-617s21c1
Sequence:CCGGCCTATCTACCTGTTTCCCTTACTCGAGTAAGGGAAACAGGTAGATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025760.4-691s21c1
Sequence:CCGGGCCATCTTTATACAGAAAGAACTCGAGTTCTTTCTGTATAAAGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025760.4-540s21c1
Sequence:CCGGGCTGAAGCATTCACCATCTATCTCGAGATAGATGGTGAATGCTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001010915
VALIDATED
PTPLAD2 MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase-like A domain containing 2
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000359953    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001010915.3-1055s21c1
Sequence:CCGGTTAGCTGCAATAGATTCAATTCTCGAGAATTGAATCTATTGCAGCTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001010915.3-419s21c1
Sequence:CCGGGATATGGTTAGGTACACTTATCTCGAGATAAGTGTACCTAACCATATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010915.3-131s21c1
Sequence:CCGGTGTGGCCACTCTTGGATATTTCTCGAGAAATATCCAAGAGTGGCCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010915.3-494s21c1
Sequence:CCGGACACTATGGATGCCAATTTATCTCGAGATAAATTGGCATCCATAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001010915
VALIDATED
PTPLAD2 MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase-like A domain containing 2
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000359953    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001010915.3-1055s21c1
Sequence:CCGGTTAGCTGCAATAGATTCAATTCTCGAGAATTGAATCTATTGCAGCTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001010915.3-419s21c1
Sequence:CCGGGATATGGTTAGGTACACTTATCTCGAGATAAGTGTACCTAACCATATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010915.3-131s21c1
Sequence:CCGGTGTGGCCACTCTTGGATATTTCTCGAGAAATATCCAAGAGTGGCCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010915.3-494s21c1
Sequence:CCGGACACTATGGATGCCAATTTATCTCGAGATAAATTGGCATCCATAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001010915
VALIDATED
PTPLAD2 MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase-like A domain containing 2
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000359953    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001010915.3-1055s21c1
Sequence:CCGGTTAGCTGCAATAGATTCAATTCTCGAGAATTGAATCTATTGCAGCTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001010915.3-419s21c1
Sequence:CCGGGATATGGTTAGGTACACTTATCTCGAGATAAGTGTACCTAACCATATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010915.3-131s21c1
Sequence:CCGGTGTGGCCACTCTTGGATATTTCTCGAGAAATATCCAAGAGTGGCCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010915.3-494s21c1
Sequence:CCGGACACTATGGATGCCAATTTATCTCGAGATAAATTGGCATCCATAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)