EMAIL THIS PAGE TO A FRIEND

PTPLB

protein tyrosine phosphatase-like (proline instead of catalytic arginine), member b

175 Gene Product Result for
Synonyms: HACD2
UniProtKB ID: Q6Y1H2
Gene ID:
Mouse(70757) protein tyrosine phosphatase-like (proline instead of catalytic arginine), member b
Rat(288058) protein tyrosine phosphatase-like (proline instead of catalytic arginine), member b
Zebrafish(334121) protein tyrosine phosphatase-like (proline instead of catalytic arginine), member b
dog(608764) protein tyrosine phosphatase-like (proline instead of catalytic arginine), member b
domestic cat(101100993) protein tyrosine phosphatase-like (proline instead of catalytic arginine), member b
chicken(424251) protein tyrosine phosphatase-like (proline instead of catalytic arginine), member b
cow(613886) protein tyrosine phosphatase-like (proline instead of catalytic arginine), member b
sheep(101120135) protein tyrosine phosphatase-like (proline instead of catalytic arginine), member b
domestic guinea pig(100714453) protein tyrosine phosphatase-like (proline instead of catalytic arginine), member b
naked mole-rat(101703393) protein tyrosine phosphatase-like (proline instead of catalytic arginine), member b
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302912 ANTI-PTPLB (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution hamster, human, mouse
flow cytometry, immunohistochemistry, western blot pricing
SAB1402046 Anti-PTPLB antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198402 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198402 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198402 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023587 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023587 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023587 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198402 Rosetta Predictions human pricing
XM_001071670 Rosetta Predictions rat pricing
XM_213610 Rosetta Predictions rat pricing
NM_023587 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198402 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055253 predicted 689
2 SASI_Hs01_00055254 predicted 733
3 SASI_Hs01_00055255 predicted 638
4 SASI_Hs01_00055256 predicted 630
5 SASI_Hs01_00055257 predicted 586
6 SASI_Hs01_00055258 predicted 401
7 SASI_Hs01_00055259 predicted 886
8 SASI_Hs02_00371926 predicted 414
9 SASI_Hs01_00055260 predicted 417
10 SASI_Hs01_00055261 predicted 357
11 SASI_Hs01_00055252 predicted 877
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071670 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00335970 predicted 476
2 SASI_Rn02_00335971 predicted 1586
3 SASI_Rn02_00335972 predicted 656
4 SASI_Rn02_00335973 predicted 818
5 SASI_Rn02_00335974 predicted 724
6 SASI_Rn02_00335975 predicted 969
7 SASI_Rn02_00335976 predicted 761
8 SASI_Rn02_00335977 predicted 1519
9 SASI_Rn02_00335978 predicted 675
10 SASI_Rn02_00335979 predicted 898
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_213610 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00374766 predicted 417
2 SASI_Rn02_00374767 predicted 1277
3 SASI_Rn02_00374768 predicted 259
4 SASI_Rn02_00374769 predicted 347
5 SASI_Rn02_00374770 predicted 425
6 SASI_Rn02_00374771 predicted 490
7 SASI_Rn02_00374772 predicted 459
8 SASI_Rn02_00374773 predicted 1214
9 SASI_Rn02_00374774 predicted 585
10 SASI_Rn02_00374775 predicted 603
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023587 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119793 predicted 347
2 SASI_Mm01_00119794 predicted 650
3 SASI_Mm01_00119795 predicted 264
4 SASI_Mm02_00327198 predicted 1215
5 SASI_Mm01_00119796 predicted 651
6 SASI_Mm01_00119798 predicted 1204
7 SASI_Mm01_00119799 predicted 263
8 SASI_Mm02_00327199 predicted 661
9 SASI_Mm01_00119800 predicted 453
10 SASI_Mm02_00327200 predicted 517
11 SASI_Mm01_00119797 predicted 274
12 SASI_Mm01_00119801 predicted 420
13 SASI_Mm01_00119802 predicted 1292
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198402
VALIDATED
PTPLB MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase-like (proline instead of catalytic arginine), member b
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377614    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198402.3-1008s21c1
Sequence:CCGGACACCCTGGCCAGTTCATTTCCTCGAGGAAATGAACTGGCCAGGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198402.3-593s21c1
Sequence:CCGGAGGAGAACTGCTCACAATATACTCGAGTATATTGTGAGCAGTTCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198402.3-632s21c1
Sequence:CCGGCAGACAAGCTGGCCTATATTCCTCGAGGAATATAGGCCAGCTTGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198402.3-715s21c1
Sequence:CCGGTGATCTCCTACATTCCAATTTCTCGAGAAATTGGAATGTAGGAGATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159059    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_198402.2-1310s1c1
Sequence:CCGGGCTTGCAGTATAGTTATGTTTCTCGAGAAACATAACTATACTGCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_198402.2-852s1c1
Sequence:CCGGCCAGTTATACTTCCACATGATCTCGAGATCATGTGGAAGTATAACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198402.2-449s1c1
Sequence:CCGGCTATAGGAATTGTTCCATCTTCTCGAGAAGATGGAACAATTCCTATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198402.2-588s1c1
Sequence:CCGGGATCACGGAAATCATCCGTTACTCGAGTAACGGATGATTTCCGTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_198402.2-593s1c1
Sequence:CCGGCGGAAATCATCCGTTACTCCTCTCGAGAGGAGTAACGGATGATTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198402.3-468s21c1
Sequence:CCGGGCATGGACGATCACGGAAATCCTCGAGGATTTCCGTGATCGTCCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198402.3-692s21c1
Sequence:CCGGCTATGCATTCCTGATTCTAATCTCGAGATTAGAATCAGGAATGCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198402.2-626s1c1
Sequence:CCGGGTCTATTAAACCATCTGCCTTCTCGAGAAGGCAGATGGTTTAATAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198402
VALIDATED
PTPLB MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase-like (proline instead of catalytic arginine), member b
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377614    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198402.3-1008s21c1
Sequence:CCGGACACCCTGGCCAGTTCATTTCCTCGAGGAAATGAACTGGCCAGGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198402.3-593s21c1
Sequence:CCGGAGGAGAACTGCTCACAATATACTCGAGTATATTGTGAGCAGTTCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198402.3-632s21c1
Sequence:CCGGCAGACAAGCTGGCCTATATTCCTCGAGGAATATAGGCCAGCTTGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198402.3-715s21c1
Sequence:CCGGTGATCTCCTACATTCCAATTTCTCGAGAAATTGGAATGTAGGAGATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159059    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_198402.2-1310s1c1
Sequence:CCGGGCTTGCAGTATAGTTATGTTTCTCGAGAAACATAACTATACTGCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_198402.2-852s1c1
Sequence:CCGGCCAGTTATACTTCCACATGATCTCGAGATCATGTGGAAGTATAACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198402.2-449s1c1
Sequence:CCGGCTATAGGAATTGTTCCATCTTCTCGAGAAGATGGAACAATTCCTATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198402.2-588s1c1
Sequence:CCGGGATCACGGAAATCATCCGTTACTCGAGTAACGGATGATTTCCGTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_198402.2-593s1c1
Sequence:CCGGCGGAAATCATCCGTTACTCCTCTCGAGAGGAGTAACGGATGATTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198402.3-468s21c1
Sequence:CCGGGCATGGACGATCACGGAAATCCTCGAGGATTTCCGTGATCGTCCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198402.3-692s21c1
Sequence:CCGGCTATGCATTCCTGATTCTAATCTCGAGATTAGAATCAGGAATGCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198402.2-626s1c1
Sequence:CCGGGTCTATTAAACCATCTGCCTTCTCGAGAAGGCAGATGGTTTAATAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198402
VALIDATED
PTPLB MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase-like (proline instead of catalytic arginine), member b
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377614    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198402.3-1008s21c1
Sequence:CCGGACACCCTGGCCAGTTCATTTCCTCGAGGAAATGAACTGGCCAGGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198402.3-593s21c1
Sequence:CCGGAGGAGAACTGCTCACAATATACTCGAGTATATTGTGAGCAGTTCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198402.3-632s21c1
Sequence:CCGGCAGACAAGCTGGCCTATATTCCTCGAGGAATATAGGCCAGCTTGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198402.3-715s21c1
Sequence:CCGGTGATCTCCTACATTCCAATTTCTCGAGAAATTGGAATGTAGGAGATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159059    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_198402.2-1310s1c1
Sequence:CCGGGCTTGCAGTATAGTTATGTTTCTCGAGAAACATAACTATACTGCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_198402.2-852s1c1
Sequence:CCGGCCAGTTATACTTCCACATGATCTCGAGATCATGTGGAAGTATAACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198402.2-449s1c1
Sequence:CCGGCTATAGGAATTGTTCCATCTTCTCGAGAAGATGGAACAATTCCTATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198402.2-588s1c1
Sequence:CCGGGATCACGGAAATCATCCGTTACTCGAGTAACGGATGATTTCCGTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_198402.2-593s1c1
Sequence:CCGGCGGAAATCATCCGTTACTCCTCTCGAGAGGAGTAACGGATGATTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198402.3-468s21c1
Sequence:CCGGGCATGGACGATCACGGAAATCCTCGAGGATTTCCGTGATCGTCCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198402.3-692s21c1
Sequence:CCGGCTATGCATTCCTGATTCTAATCTCGAGATTAGAATCAGGAATGCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198402.2-626s1c1
Sequence:CCGGGTCTATTAAACCATCTGCCTTCTCGAGAAGGCAGATGGTTTAATAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023587
PTPLB MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase-like (proline instead of catalytic arginine), member b
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023587.1-173s1c1
Sequence:CCGGGCGTACCTGGTCATCTACAATCTCGAGATTGTAGATGACCAGGTACGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023587.1-370s1c1
Sequence:CCGGCCTGACTTCTTTCCAGGTGATCTCGAGATCACCTGGAAAGAAGTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023587.1-669s1c1
Sequence:CCGGCCATCAGCTTACCTAACAAATCTCGAGATTTGTTAGGTAAGCTGATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023587.1-261s1c1
Sequence:CCGGGCTACCATAGCCTTTATTATTCTCGAGAATAATAAAGGCTATGGTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023587.1-486s1c1
Sequence:CCGGCGGAAATTATCACGGAAATTACTCGAGTAATTTCCGTGATAATTTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023587
PTPLB MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase-like (proline instead of catalytic arginine), member b
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023587.1-173s1c1
Sequence:CCGGGCGTACCTGGTCATCTACAATCTCGAGATTGTAGATGACCAGGTACGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023587.1-370s1c1
Sequence:CCGGCCTGACTTCTTTCCAGGTGATCTCGAGATCACCTGGAAAGAAGTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023587.1-669s1c1
Sequence:CCGGCCATCAGCTTACCTAACAAATCTCGAGATTTGTTAGGTAAGCTGATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023587.1-261s1c1
Sequence:CCGGGCTACCATAGCCTTTATTATTCTCGAGAATAATAAAGGCTATGGTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023587.1-486s1c1
Sequence:CCGGCGGAAATTATCACGGAAATTACTCGAGTAATTTCCGTGATAATTTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023587
PTPLB MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase-like (proline instead of catalytic arginine), member b
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023587.1-173s1c1
Sequence:CCGGGCGTACCTGGTCATCTACAATCTCGAGATTGTAGATGACCAGGTACGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023587.1-370s1c1
Sequence:CCGGCCTGACTTCTTTCCAGGTGATCTCGAGATCACCTGGAAAGAAGTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023587.1-669s1c1
Sequence:CCGGCCATCAGCTTACCTAACAAATCTCGAGATTTGTTAGGTAAGCTGATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023587.1-261s1c1
Sequence:CCGGGCTACCATAGCCTTTATTATTCTCGAGAATAATAAAGGCTATGGTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023587.1-486s1c1
Sequence:CCGGCGGAAATTATCACGGAAATTACTCGAGTAATTTCCGTGATAATTTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)