EMAIL THIS PAGE TO A FRIEND

PTPMT1

protein tyrosine phosphatase, mitochondrial 1

137 Gene Product Result for
Synonyms: DUSP23 MOSP PLIP
UniProtKB ID: Q8WUK0, E9PAT8, Q7Z557, Q96CR2, Q9BXV8
Gene ID:
Mouse(66461) protein tyrosine phosphatase, mitochondrial 1
Rat(29390) protein tyrosine phosphatase, mitochondrial 1
Zebrafish(567019) protein tyrosine phosphatase, mitochondrial 1
chicken(423181) protein tyrosine phosphatase, mitochondrial 1
dog(483622) protein tyrosine phosphatase, mitochondrial 1
domestic cat(101086089) protein tyrosine phosphatase, mitochondrial 1
naked mole-rat(101697741) protein tyrosine phosphatase, mitochondrial 1
domestic guinea pig(100727924) protein tyrosine phosphatase, mitochondrial 1
cow(614890) protein tyrosine phosphatase, mitochondrial 1
sheep(101120272) protein tyrosine phosphatase, mitochondrial 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_374879 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_374879 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_374879 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025576 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025576 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025576 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_175732 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175732 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175732 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_175732 Rosetta Predictions human pricing
NM_001105726 Rosetta Predictions rat pricing
NM_025576 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175732 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369064 predicted 517
2 SASI_Hs02_00369065 predicted 592
3 SASI_Hs02_00369066 predicted 460
4 SASI_Hs02_00369067 predicted 526
5 SASI_Hs02_00369068 predicted 422
6 SASI_Hs02_00369069 predicted 525
7 SASI_Hs02_00369070 predicted 382
8 SASI_Hs02_00369071 predicted 472
9 SASI_Hs02_00369072 predicted 380
10 SASI_Hs02_00369073 predicted 473
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105726 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211926 predicted 1186
2 SASI_Rn02_00211927 predicted 1011
3 SASI_Rn02_00211928 predicted 1024
4 SASI_Rn02_00211929 predicted 1279
5 SASI_Rn02_00211930 predicted 929
6 SASI_Rn02_00211931 predicted 1253
7 SASI_Rn02_00211932 predicted 964
8 SASI_Rn02_00211933 predicted 868
9 SASI_Rn02_00211934 predicted 845
10 SASI_Rn02_00211935 predicted 1203
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025576 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00178916 predicted 966
2 SASI_Mm01_00178917 predicted 946
3 SASI_Mm01_00178918 predicted 1037
4 SASI_Mm01_00178919 predicted 640
5 SASI_Mm01_00178921 predicted 696
6 SASI_Mm02_00328554 predicted 603
7 SASI_Mm01_00178922 predicted 919
8 SASI_Mm02_00328555 predicted 556
9 SASI_Mm01_00178923 predicted 532
10 SASI_Mm01_00178924 predicted 973
11 SASI_Mm01_00178915 predicted 717
12 SASI_Mm01_00178920 predicted 716
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_374879
VALIDATED
PTPMT1 MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase, mitochondrial 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000174256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374879.1-547s1c2
Sequence:CCGGGCTGGATGTTCTTAAAGAGTTCTCGAGAACTCTTTAAGAACATCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_374879.1-514s1c1
Sequence:CCGGGATCCGGTCATACATCCACATCTCGAGATGTGGATGTATGACCGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_374879.1-547s1c1
Sequence:CCGGGCTGGATGTTCTTAAAGAGTTCTCGAGAACTCTTTAAGAACATCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_374879.1-247s1c1
Sequence:CCGGCGAGACGAGGTTCCTGTGCAACTCGAGTTGCACAGGAACCTCGTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_374879.1-400s1c1
Sequence:CCGGGTGTGTTTACGTGCATTGTAACTCGAGTTACAATGCACGTAAACACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_374879.1-316s1c1
Sequence:CCGGCACAGTAGACATGACTGGGATCTCGAGATCCCAGTCATGTCTACTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374879.1-316s1c2
Sequence:CCGGCACAGTAGACATGACTGGGATCTCGAGATCCCAGTCATGTCTACTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_374879
VALIDATED
PTPMT1 MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase, mitochondrial 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000174256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374879.1-547s1c2
Sequence:CCGGGCTGGATGTTCTTAAAGAGTTCTCGAGAACTCTTTAAGAACATCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_374879.1-514s1c1
Sequence:CCGGGATCCGGTCATACATCCACATCTCGAGATGTGGATGTATGACCGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_374879.1-547s1c1
Sequence:CCGGGCTGGATGTTCTTAAAGAGTTCTCGAGAACTCTTTAAGAACATCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_374879.1-247s1c1
Sequence:CCGGCGAGACGAGGTTCCTGTGCAACTCGAGTTGCACAGGAACCTCGTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_374879.1-400s1c1
Sequence:CCGGGTGTGTTTACGTGCATTGTAACTCGAGTTACAATGCACGTAAACACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_374879.1-316s1c1
Sequence:CCGGCACAGTAGACATGACTGGGATCTCGAGATCCCAGTCATGTCTACTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374879.1-316s1c2
Sequence:CCGGCACAGTAGACATGACTGGGATCTCGAGATCCCAGTCATGTCTACTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_374879
VALIDATED
PTPMT1 MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase, mitochondrial 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000174256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374879.1-547s1c2
Sequence:CCGGGCTGGATGTTCTTAAAGAGTTCTCGAGAACTCTTTAAGAACATCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_374879.1-514s1c1
Sequence:CCGGGATCCGGTCATACATCCACATCTCGAGATGTGGATGTATGACCGGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_374879.1-547s1c1
Sequence:CCGGGCTGGATGTTCTTAAAGAGTTCTCGAGAACTCTTTAAGAACATCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_374879.1-247s1c1
Sequence:CCGGCGAGACGAGGTTCCTGTGCAACTCGAGTTGCACAGGAACCTCGTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_374879.1-400s1c1
Sequence:CCGGGTGTGTTTACGTGCATTGTAACTCGAGTTACAATGCACGTAAACACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_374879.1-316s1c1
Sequence:CCGGCACAGTAGACATGACTGGGATCTCGAGATCCCAGTCATGTCTACTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374879.1-316s1c2
Sequence:CCGGCACAGTAGACATGACTGGGATCTCGAGATCCCAGTCATGTCTACTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025576
VALIDATED
PTPMT1 MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase, mitochondrial 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025576.1-772s1c1
Sequence:CCGGGCTGGAAGTTCTCAAAGAGTTCTCGAGAACTCTTTGAGAACTTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025576.1-1115s1c1
Sequence:CCGGGCACTGTAAATCAAAGACATTCTCGAGAATGTCTTTGATTTACAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025576.1-719s1c1
Sequence:CCGGGCTATAGAAGCGATCGCCAAACTCGAGTTTGGCGATCGCTTCTATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025576.1-451s1c1
Sequence:CCGGGATCACTATGAACGAGGAGTACTCGAGTACTCCTCGTTCATAGTGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025576.1-652s1c1
Sequence:CCGGTCGATCCAGAAGTGCCACAATCTCGAGATTGTGGCACTTCTGGATCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349918    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025576.2-912s21c1
Sequence:CCGGATCTCCCTGAGATATAGTAACCTCGAGGTTACTATATCTCAGGGAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025576.2-793s21c1
Sequence:CCGGGCTGGAAGTTCTCAAAGAGTTCTCGAGAACTCTTTGAGAACTTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025576.2-472s21c1
Sequence:CCGGGATCACTATGAACGAGGAGTACTCGAGTACTCCTCGTTCATAGTGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025576.2-740s21c1
Sequence:CCGGGCTATAGAAGCGATCGCCAAACTCGAGTTTGGCGATCGCTTCTATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025576.2-674s21c1
Sequence:CCGGCGATCCAGAAGTGCCACAATGCTCGAGCATTGTGGCACTTCTGGATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025576
VALIDATED
PTPMT1 MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase, mitochondrial 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025576.1-772s1c1
Sequence:CCGGGCTGGAAGTTCTCAAAGAGTTCTCGAGAACTCTTTGAGAACTTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025576.1-1115s1c1
Sequence:CCGGGCACTGTAAATCAAAGACATTCTCGAGAATGTCTTTGATTTACAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025576.1-719s1c1
Sequence:CCGGGCTATAGAAGCGATCGCCAAACTCGAGTTTGGCGATCGCTTCTATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025576.1-451s1c1
Sequence:CCGGGATCACTATGAACGAGGAGTACTCGAGTACTCCTCGTTCATAGTGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025576.1-652s1c1
Sequence:CCGGTCGATCCAGAAGTGCCACAATCTCGAGATTGTGGCACTTCTGGATCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349918    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025576.2-912s21c1
Sequence:CCGGATCTCCCTGAGATATAGTAACCTCGAGGTTACTATATCTCAGGGAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025576.2-793s21c1
Sequence:CCGGGCTGGAAGTTCTCAAAGAGTTCTCGAGAACTCTTTGAGAACTTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025576.2-472s21c1
Sequence:CCGGGATCACTATGAACGAGGAGTACTCGAGTACTCCTCGTTCATAGTGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025576.2-740s21c1
Sequence:CCGGGCTATAGAAGCGATCGCCAAACTCGAGTTTGGCGATCGCTTCTATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025576.2-674s21c1
Sequence:CCGGCGATCCAGAAGTGCCACAATGCTCGAGCATTGTGGCACTTCTGGATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025576
VALIDATED
PTPMT1 MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase, mitochondrial 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025576.1-772s1c1
Sequence:CCGGGCTGGAAGTTCTCAAAGAGTTCTCGAGAACTCTTTGAGAACTTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025576.1-1115s1c1
Sequence:CCGGGCACTGTAAATCAAAGACATTCTCGAGAATGTCTTTGATTTACAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025576.1-719s1c1
Sequence:CCGGGCTATAGAAGCGATCGCCAAACTCGAGTTTGGCGATCGCTTCTATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025576.1-451s1c1
Sequence:CCGGGATCACTATGAACGAGGAGTACTCGAGTACTCCTCGTTCATAGTGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025576.1-652s1c1
Sequence:CCGGTCGATCCAGAAGTGCCACAATCTCGAGATTGTGGCACTTCTGGATCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349918    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025576.2-912s21c1
Sequence:CCGGATCTCCCTGAGATATAGTAACCTCGAGGTTACTATATCTCAGGGAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025576.2-793s21c1
Sequence:CCGGGCTGGAAGTTCTCAAAGAGTTCTCGAGAACTCTTTGAGAACTTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025576.2-472s21c1
Sequence:CCGGGATCACTATGAACGAGGAGTACTCGAGTACTCCTCGTTCATAGTGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025576.2-740s21c1
Sequence:CCGGGCTATAGAAGCGATCGCCAAACTCGAGTTTGGCGATCGCTTCTATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025576.2-674s21c1
Sequence:CCGGCGATCCAGAAGTGCCACAATGCTCGAGCATTGTGGCACTTCTGGATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175732
PTPMT1 MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase, mitochondrial 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000289105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175732.2-718s21c1
Sequence:CCGGGCTGGATGTTCTTAAAGAGTTCTCGAGAACTCTTTAAGAACATCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175732.2-571s21c1
Sequence:CCGGGTGTGTTTACGTGCATTGTAACTCGAGTTACAATGCACGTAAACACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175732.2-685s21c1
Sequence:CCGGGATCCGGTCATACATCCACATCTCGAGATGTGGATGTATGACCGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175732.2-418s21c1
Sequence:CCGGCGAGACGAGGTTCCTGTGCAACTCGAGTTGCACAGGAACCTCGTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175732.2-487s21c1
Sequence:CCGGCACAGTAGACATGACTGGGATCTCGAGATCCCAGTCATGTCTACTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175732
PTPMT1 MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase, mitochondrial 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000289105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175732.2-718s21c1
Sequence:CCGGGCTGGATGTTCTTAAAGAGTTCTCGAGAACTCTTTAAGAACATCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175732.2-571s21c1
Sequence:CCGGGTGTGTTTACGTGCATTGTAACTCGAGTTACAATGCACGTAAACACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175732.2-685s21c1
Sequence:CCGGGATCCGGTCATACATCCACATCTCGAGATGTGGATGTATGACCGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175732.2-418s21c1
Sequence:CCGGCGAGACGAGGTTCCTGTGCAACTCGAGTTGCACAGGAACCTCGTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175732.2-487s21c1
Sequence:CCGGCACAGTAGACATGACTGGGATCTCGAGATCCCAGTCATGTCTACTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175732
PTPMT1 MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase, mitochondrial 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000289105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175732.2-718s21c1
Sequence:CCGGGCTGGATGTTCTTAAAGAGTTCTCGAGAACTCTTTAAGAACATCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175732.2-571s21c1
Sequence:CCGGGTGTGTTTACGTGCATTGTAACTCGAGTTACAATGCACGTAAACACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175732.2-685s21c1
Sequence:CCGGGATCCGGTCATACATCCACATCTCGAGATGTGGATGTATGACCGGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175732.2-418s21c1
Sequence:CCGGCGAGACGAGGTTCCTGTGCAACTCGAGTTGCACAGGAACCTCGTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175732.2-487s21c1
Sequence:CCGGCACAGTAGACATGACTGGGATCTCGAGATCCCAGTCATGTCTACTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)