EMAIL THIS PAGE TO A FRIEND

PTPN11

protein tyrosine phosphatase, non-receptor type 11

119 Gene Product Result for
Synonyms: BPTP3 CFC NS1 PTP-1D PTP2C SH-PTP2 SH-PTP3 SHP2
UniProtKB ID: Q06124, A8K1D9, Q96HD7
Gene ID:
Human(5781) Summary: The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains two tandem Src homology-2 domains, which function as phospho-tyrosine binding domains and mediate the interaction of this PTP with its substrates. This PTP is widely expressed in most tissues and plays a regulatory role in various cell signaling events that are important for a diversity of cell functions, such as mitogenic activation, metabolic control, transcription regulation, and cell migration. Mutations in this gene are a cause of Noonan syndrome as well as acute myeloid leukemia. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
Mouse(19247) protein tyrosine phosphatase, non-receptor type 11
Rat(25622) protein tyrosine phosphatase, non-receptor type 11
chicken(395815) protein tyrosine phosphatase, non-receptor type 11
dog(477488) protein tyrosine phosphatase, non-receptor type 11
domestic cat(101085500) protein tyrosine phosphatase, non-receptor type 11
Horse(100056857) protein tyrosine phosphatase, non-receptor type 11
naked mole-rat(101701336) protein tyrosine phosphatase, non-receptor type 11
domestic guinea pig(100732797) protein tyrosine phosphatase, non-receptor type 11
cow(533590) protein tyrosine phosphatase, non-receptor type 11
sheep(101114308) protein tyrosine phosphatase, non-receptor type 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4300249 Anti- pTyr580 antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunohistochemistry pricing
SAB4300248 Anti-phospho-PTPN11 (pTyr542) antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunohistochemistry, western blot pricing
SAB4503777 Anti-phospho-SHP-2 (pTyr542) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB1100372 Anti-PTPN11 (386-400) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB4300559 Anti-PTPN11 (Ab-542) antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300560 Anti-PTPN11 (Ab-580) antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunofluorescence, immunohistochemistry, western blot pricing
SAB2900281 Anti-PTPN11 (AB1) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human, rat
immunohistochemistry, western blot pricing
SAB2900375 Anti-PTPN11 (AB2) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, human, mouse
immunohistochemistry, western blot pricing
GW21495A Anti-PTPN11 antibody produced in chicken affinity isolated antibody, buffered aqueous solution human, rat
western blot pricing
SAB1406345 Anti-PTPN11 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
proximity ligation assay, western blot pricing
SAB4502536 Anti-SH-PTP2 antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4502534 Anti-SHP-2 antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB4502535 Anti-SHP-2 antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
06-118 Anti-SHP-2/SHPTP-2 Antibody Detect SHP-2/SHPTP-2 using this Anti-SHP-2/SHPTP-2 Antibody validated for use in IC & WB. mouse, human, human, mouse
immunocytochemistry, western blot pricing
PRS3901 Anti-SHP2 (ab1) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, rat, human
ELISA, western blot pricing
PRS3903 Anti-SHP2 (ab2) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, rat, mouse
ELISA, immunofluorescence, western blot pricing
SAB1301000 Anti-SHP2 (Y584) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB1300500 Anti-SHP2 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, western blot pricing
SAB2500939 Anti-SHP2/PTPN11 antibody produced in goat affinity isolated antibody, buffered aqueous solution human, mouse, rat
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011202 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011202 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011202 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002834 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002834 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002834 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002834 siRNAs that have been validated in the lab human pricing
NM_013088 Rosetta Predictions rat pricing
NM_001109992 Rosetta Predictions mouse pricing
NM_011202 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002834 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207375 validated 1433
1 SASI_Hs01_00207376 validated 1820
1 SASI_Hs01_00207374 validated 1989
2 SASI_Hs02_00334550 predicted 849
3 SASI_Hs01_00207379 predicted 617
4 SASI_Hs02_00334551 predicted 620
5 SASI_Hs01_00207381 predicted 651
6 SASI_Hs02_00334552 predicted 391
7 SASI_Hs02_00334553 predicted 1824
8 SASI_Hs02_00334554 predicted 674
9 SASI_Hs02_00334555 predicted 2219
10 SASI_Hs01_00207377 predicted 1547
11 SASI_Hs01_00207378 predicted 1899
12 SASI_Hs01_00207380 predicted 1470
13 SASI_Hs01_00207382 predicted 2254
14 SASI_Hs01_00207383 predicted 2099
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013088 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105327 predicted 1549
2 SASI_Rn01_00105328 predicted 1711
3 SASI_Rn01_00105329 predicted 367
4 SASI_Rn01_00105330 predicted 1501
5 SASI_Rn01_00105331 predicted 1207
6 SASI_Rn01_00105333 predicted 1494
7 SASI_Rn01_00105334 predicted 320
8 SASI_Rn02_00260855 predicted 490
9 SASI_Rn01_00105335 predicted 1745
10 SASI_Rn01_00105336 predicted 1259
11 SASI_Rn01_00105332 predicted 577
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109992 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304544 predicted 1634
2 SASI_Mm02_00304545 predicted 328
3 SASI_Mm02_00304546 predicted 1833
4 SASI_Mm02_00304547 predicted 478
5 SASI_Mm02_00304548 predicted 328
6 SASI_Mm02_00304549 predicted 394
7 SASI_Mm02_00304550 predicted 1715
8 SASI_Mm02_00304551 predicted 440
9 SASI_Mm02_00304552 predicted 1797
10 SASI_Mm02_00304553 predicted 610
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011202 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099118 predicted 1647
2 SASI_Mm01_00099119 predicted 323
3 SASI_Mm01_00099120 predicted 1842
4 SASI_Mm02_00320131 predicted 477
5 SASI_Mm02_00320132 predicted 329
6 SASI_Mm01_00099125 predicted 391
7 SASI_Mm02_00320133 predicted 1725
8 SASI_Mm01_00099126 predicted 443
9 SASI_Mm01_00099127 predicted 1806
10 SASI_Mm02_00320134 predicted 606
11 SASI_Mm01_00099121 predicted 1283
12 SASI_Mm01_00099122 predicted 1529
13 SASI_Mm01_00099123 predicted 1537
14 SASI_Mm01_00099124 predicted 1357
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011202
VALIDATED
PTPN11 MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase, non-receptor type 11
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011202.2-1264s1c1
Sequence:CCGGCGTGTTAGGAACGTCAAAGAACTCGAGTTCTTTGACGTTCCTAACACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011202.3-1611s21c1
Sequence:CCGGGACATCCTTATTGACATCATTCTCGAGAATGATGTCAATAAGGATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011202.2-1228s1c1
Sequence:CCGGCCTGATGAGTATGCGCTCAAACTCGAGTTTGAGCGCATACTCATCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011202.2-1543s1c1
Sequence:CCGGGACATCCTTATTGACATCATTCTCGAGAATGATGTCAATAAGGATGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011202.2-770s1c1
Sequence:CCGGCTCGTATCAATGCTGCTGAAACTCGAGTTTCAGCAGCATTGATACGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029874    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011202.2-2289s1c1
Sequence:CCGGCCCTTGTAAGAAGAAAGGATTCTCGAGAATCCTTTCTTCTTACAAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011202.3-1123s21c1
Sequence:CCGGTTGAGACCAAGTGCAACAATTCTCGAGAATTGTTGCACTTGGTCTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011202.3-1332s21c1
Sequence:CCGGCGTGTTAGGAACGTCAAAGAACTCGAGTTCTTTGACGTTCCTAACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011202.3-1296s21c1
Sequence:CCGGCCTGATGAGTATGCGCTCAAACTCGAGTTTGAGCGCATACTCATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011202
VALIDATED
PTPN11 MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase, non-receptor type 11
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011202.2-1264s1c1
Sequence:CCGGCGTGTTAGGAACGTCAAAGAACTCGAGTTCTTTGACGTTCCTAACACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011202.3-1611s21c1
Sequence:CCGGGACATCCTTATTGACATCATTCTCGAGAATGATGTCAATAAGGATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011202.2-1228s1c1
Sequence:CCGGCCTGATGAGTATGCGCTCAAACTCGAGTTTGAGCGCATACTCATCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011202.2-1543s1c1
Sequence:CCGGGACATCCTTATTGACATCATTCTCGAGAATGATGTCAATAAGGATGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011202.2-770s1c1
Sequence:CCGGCTCGTATCAATGCTGCTGAAACTCGAGTTTCAGCAGCATTGATACGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029874    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011202.2-2289s1c1
Sequence:CCGGCCCTTGTAAGAAGAAAGGATTCTCGAGAATCCTTTCTTCTTACAAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011202.3-1123s21c1
Sequence:CCGGTTGAGACCAAGTGCAACAATTCTCGAGAATTGTTGCACTTGGTCTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011202.3-1332s21c1
Sequence:CCGGCGTGTTAGGAACGTCAAAGAACTCGAGTTCTTTGACGTTCCTAACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011202.3-1296s21c1
Sequence:CCGGCCTGATGAGTATGCGCTCAAACTCGAGTTTGAGCGCATACTCATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011202
VALIDATED
PTPN11 MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase, non-receptor type 11
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011202.2-1264s1c1
Sequence:CCGGCGTGTTAGGAACGTCAAAGAACTCGAGTTCTTTGACGTTCCTAACACGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011202.3-1611s21c1
Sequence:CCGGGACATCCTTATTGACATCATTCTCGAGAATGATGTCAATAAGGATGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011202.2-1228s1c1
Sequence:CCGGCCTGATGAGTATGCGCTCAAACTCGAGTTTGAGCGCATACTCATCAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011202.2-1543s1c1
Sequence:CCGGGACATCCTTATTGACATCATTCTCGAGAATGATGTCAATAAGGATGTCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011202.2-770s1c1
Sequence:CCGGCTCGTATCAATGCTGCTGAAACTCGAGTTTCAGCAGCATTGATACGAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029874    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011202.2-2289s1c1
Sequence:CCGGCCCTTGTAAGAAGAAAGGATTCTCGAGAATCCTTTCTTCTTACAAGGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011202.3-1123s21c1
Sequence:CCGGTTGAGACCAAGTGCAACAATTCTCGAGAATTGTTGCACTTGGTCTCAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011202.3-1332s21c1
Sequence:CCGGCGTGTTAGGAACGTCAAAGAACTCGAGTTCTTTGACGTTCCTAACACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011202.3-1296s21c1
Sequence:CCGGCCTGATGAGTATGCGCTCAAACTCGAGTTTGAGCGCATACTCATCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002834
VALIDATED
PTPN11 MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase, non-receptor type 11
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000314564    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002834.3-2488s21c1
Sequence:CCGGGGATTCAAATTCTAGTAATAGCTCGAGCTATTACTAGAATTTGAATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005002    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002834.3-2452s1c1
Sequence:CCGGGCAGTTAAATTGTGCGCTGTACTCGAGTACAGCGCACAATTTAACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002834.3-659s21c1
Sequence:CCGGAGATGTCATTGAGCTTAAATACTCGAGTATTTAAGCTCAATGACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A-431
TRC Version: 1 Clone ID:NM_002834.3-1050s1c1
Sequence:CCGGGCTGAAATAGAAAGCAGAGTTCTCGAGAACTCTGCTTTCTATTTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002834.3-1299s1c1
Sequence:CCGGGCAAATATCATCATGCCTGAACTCGAGTTCAGGCATGATGATATTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002834.3-1930s1c1
Sequence:CCGGCGGTCCAGCATTATATTGAAACTCGAGTTTCAATATAATGCTGGACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002834.3-1570s1c1
Sequence:CCGGCGCTAAGAGAACTTAAACTTTCTCGAGAAAGTTTAAGTTCTCTTAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314563    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002834.3-2452s21c1
Sequence:CCGGGCAGTTAAATTGTGCGCTGTACTCGAGTACAGCGCACAATTTAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002834.3-871s21c1
Sequence:CCGGAGTCTAAAGTGACCCATGTTACTCGAGTAACATGGGTCACTTTAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350369    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002834.3-2528s21c1
Sequence:CCGGTATACCCTTAACCAGTTTAATCTCGAGATTAAACTGGTTAAGGGTATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002834.3-1570s21c1
Sequence:CCGGCGCTAAGAGAACTTAAACTTTCTCGAGAAAGTTTAAGTTCTCTTAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002834
VALIDATED
PTPN11 MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase, non-receptor type 11
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000314564    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002834.3-2488s21c1
Sequence:CCGGGGATTCAAATTCTAGTAATAGCTCGAGCTATTACTAGAATTTGAATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005002    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002834.3-2452s1c1
Sequence:CCGGGCAGTTAAATTGTGCGCTGTACTCGAGTACAGCGCACAATTTAACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002834.3-659s21c1
Sequence:CCGGAGATGTCATTGAGCTTAAATACTCGAGTATTTAAGCTCAATGACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A-431
TRC Version: 1 Clone ID:NM_002834.3-1050s1c1
Sequence:CCGGGCTGAAATAGAAAGCAGAGTTCTCGAGAACTCTGCTTTCTATTTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002834.3-1299s1c1
Sequence:CCGGGCAAATATCATCATGCCTGAACTCGAGTTCAGGCATGATGATATTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002834.3-1930s1c1
Sequence:CCGGCGGTCCAGCATTATATTGAAACTCGAGTTTCAATATAATGCTGGACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002834.3-1570s1c1
Sequence:CCGGCGCTAAGAGAACTTAAACTTTCTCGAGAAAGTTTAAGTTCTCTTAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314563    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002834.3-2452s21c1
Sequence:CCGGGCAGTTAAATTGTGCGCTGTACTCGAGTACAGCGCACAATTTAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002834.3-871s21c1
Sequence:CCGGAGTCTAAAGTGACCCATGTTACTCGAGTAACATGGGTCACTTTAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350369    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002834.3-2528s21c1
Sequence:CCGGTATACCCTTAACCAGTTTAATCTCGAGATTAAACTGGTTAAGGGTATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002834.3-1570s21c1
Sequence:CCGGCGCTAAGAGAACTTAAACTTTCTCGAGAAAGTTTAAGTTCTCTTAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002834
VALIDATED
PTPN11 MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase, non-receptor type 11
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000314564    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002834.3-2488s21c1
Sequence:CCGGGGATTCAAATTCTAGTAATAGCTCGAGCTATTACTAGAATTTGAATCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005002    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002834.3-2452s1c1
Sequence:CCGGGCAGTTAAATTGTGCGCTGTACTCGAGTACAGCGCACAATTTAACTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002834.3-659s21c1
Sequence:CCGGAGATGTCATTGAGCTTAAATACTCGAGTATTTAAGCTCAATGACATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A-431
TRC Version: 1 Clone ID:NM_002834.3-1050s1c1
Sequence:CCGGGCTGAAATAGAAAGCAGAGTTCTCGAGAACTCTGCTTTCTATTTCAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002834.3-1299s1c1
Sequence:CCGGGCAAATATCATCATGCCTGAACTCGAGTTCAGGCATGATGATATTTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002834.3-1930s1c1
Sequence:CCGGCGGTCCAGCATTATATTGAAACTCGAGTTTCAATATAATGCTGGACCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002834.3-1570s1c1
Sequence:CCGGCGCTAAGAGAACTTAAACTTTCTCGAGAAAGTTTAAGTTCTCTTAGCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314563    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002834.3-2452s21c1
Sequence:CCGGGCAGTTAAATTGTGCGCTGTACTCGAGTACAGCGCACAATTTAACTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002834.3-871s21c1
Sequence:CCGGAGTCTAAAGTGACCCATGTTACTCGAGTAACATGGGTCACTTTAGACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350369    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002834.3-2528s21c1
Sequence:CCGGTATACCCTTAACCAGTTTAATCTCGAGATTAAACTGGTTAAGGGTATATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002834.3-1570s21c1
Sequence:CCGGCGCTAAGAGAACTTAAACTTTCTCGAGAAAGTTTAAGTTCTCTTAGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)