EMAIL THIS PAGE TO A FRIEND

PTPN12

protein tyrosine phosphatase, non-receptor type 12

142 Gene Product Result for
Synonyms: PTP-PEST PTPG1
Gene ID:
Human(5782) Summary: The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains a C-terminal PEST motif, which serves as a protein-protein interaction domain, and may regulate protein intracellular half-life. This PTP was found to bind and dephosphorylate the product of the oncogene c-ABL and thus may play a role in oncogenesis. This PTP was also shown to interact with, and dephosphorylate, various products related to cytoskeletal structure and cell adhesion, such as p130 (Cas), CAKbeta/PTK2B, PSTPIP1, and paxillin. This suggests it has a regulatory role in controlling cell shape and mobility. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Oct 2008]
Mouse(19248) protein tyrosine phosphatase, non-receptor type 12
Rat(117255) protein tyrosine phosphatase, non-receptor type 12
Zebrafish(393642) protein tyrosine phosphatase, non-receptor type 12
Horse(100057833) protein tyrosine phosphatase, non-receptor type 12
domestic cat(101091096) protein tyrosine phosphatase, non-receptor type 12
dog(483277) protein tyrosine phosphatase, non-receptor type 12
chicken(417725) protein tyrosine phosphatase, non-receptor type 12
cow(531877) protein tyrosine phosphatase, non-receptor type 12
sheep(101117497) protein tyrosine phosphatase, non-receptor type 12
domestic guinea pig(100725572) protein tyrosine phosphatase, non-receptor type 12
naked mole-rat(101697685) protein tyrosine phosphatase, non-receptor type 12
Domestic Rabbit(100350817) protein tyrosine phosphatase, non-receptor type 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002835 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002835 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002835 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011203 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011203 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011203 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002835 siRNAs that have been validated in the lab human pricing
NM_057115 Rosetta Predictions rat pricing
XM_579592 Rosetta Predictions rat pricing
NM_011203 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002835 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062655 validated 876
2 SASI_Hs01_00062656 predicted 2231
3 SASI_Hs02_00334556 predicted 619
4 SASI_Hs01_00062657 predicted 1938
5 SASI_Hs01_00062658 predicted 871
6 SASI_Hs01_00062659 predicted 228
7 SASI_Hs02_00334557 predicted 1690
8 SASI_Hs01_00062661 predicted 888
9 SASI_Hs01_00062664 predicted 382
10 SASI_Hs02_00334558 predicted 2362
11 SASI_Hs01_00062660 predicted 1978
12 SASI_Hs01_00062662 predicted 1671
13 SASI_Hs01_00062663 predicted 1746
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057115 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267048 predicted 1486
2 SASI_Rn02_00267049 predicted 2173
3 SASI_Rn02_00267050 predicted 271
4 SASI_Rn02_00267051 predicted 1497
5 SASI_Rn01_00030248 predicted 924
6 SASI_Rn01_00030252 predicted 783
7 SASI_Rn01_00030253 predicted 715
8 SASI_Rn02_00267052 predicted 2038
9 SASI_Rn01_00030254 predicted 519
10 SASI_Rn01_00030256 predicted 907
11 SASI_Rn01_00030249 predicted 798
12 SASI_Rn01_00030250 predicted 750
13 SASI_Rn01_00030251 predicted 795
14 SASI_Rn01_00030255 predicted 589
15 SASI_Rn01_00030257 predicted 1346
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579592 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00161953 predicted 1017
2 SASI_Rn01_00161954 predicted 1016
3 SASI_Rn01_00161955 predicted 1015
4 SASI_Rn01_00161956 predicted 990
5 SASI_Rn01_00161957 predicted 1030
6 SASI_Rn01_00161958 predicted 985
7 SASI_Rn01_00161959 predicted 996
8 SASI_Rn01_00161960 predicted 1034
9 SASI_Rn01_00161961 predicted 987
10 SASI_Rn01_00161962 predicted 991
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011203 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139703 predicted 1499
2 SASI_Mm01_00139704 predicted 2426
3 SASI_Mm01_00139705 predicted 1463
4 SASI_Mm01_00139706 predicted 637
5 SASI_Mm01_00139707 predicted 251
6 SASI_Mm01_00139708 predicted 2033
7 SASI_Mm01_00139709 predicted 2398
8 SASI_Mm01_00139710 predicted 1318
9 SASI_Mm01_00139711 predicted 1307
10 SASI_Mm01_00139712 predicted 507
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002835
VALIDATED
PTPN12 MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase, non-receptor type 12
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002835.3-1619s21c1
Sequence:CCGGCCACCAGAAGAATCCCAGAATCTCGAGATTCTGGGATTCTTCTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002835.3-552s21c1
Sequence:CCGGCCATAACGTTTGCACCATTTACTCGAGTAAATGGTGCAAACGTTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002835.3-820s21c1
Sequence:CCGGCATAGATTATACGTGGAATTTCTCGAGAAATTCCACGTATAATCTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002835.x-245s1c1
Sequence:CCGGCAGCCGAGTTAAATTGACATTCTCGAGAATGTCAATTTAACTCGGCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002835.x-1557s1c1
Sequence:CCGGCCACCAGAAGAATCCCAGAATCTCGAGATTCTGGGATTCTTCTGGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002832    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002835.x-2882s1c1
Sequence:CCGGGCTTTGCAGGTTATCAGAGATCTCGAGATCTCTGATAACCTGCAAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002835.x-427s1c1
Sequence:CCGGGCCGAGAATTTGAGATGGGAACTCGAGTTCCCATCTCAAATTCTCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002835.x-1659s1c1
Sequence:CCGGGCCATACCCATACCTGATTTACTCGAGTAAATCAGGTATGGGTATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002835
VALIDATED
PTPN12 MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase, non-receptor type 12
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002835.3-1619s21c1
Sequence:CCGGCCACCAGAAGAATCCCAGAATCTCGAGATTCTGGGATTCTTCTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002835.3-552s21c1
Sequence:CCGGCCATAACGTTTGCACCATTTACTCGAGTAAATGGTGCAAACGTTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002835.3-820s21c1
Sequence:CCGGCATAGATTATACGTGGAATTTCTCGAGAAATTCCACGTATAATCTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002835.x-245s1c1
Sequence:CCGGCAGCCGAGTTAAATTGACATTCTCGAGAATGTCAATTTAACTCGGCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002835.x-1557s1c1
Sequence:CCGGCCACCAGAAGAATCCCAGAATCTCGAGATTCTGGGATTCTTCTGGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002832    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002835.x-2882s1c1
Sequence:CCGGGCTTTGCAGGTTATCAGAGATCTCGAGATCTCTGATAACCTGCAAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002835.x-427s1c1
Sequence:CCGGGCCGAGAATTTGAGATGGGAACTCGAGTTCCCATCTCAAATTCTCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002835.x-1659s1c1
Sequence:CCGGGCCATACCCATACCTGATTTACTCGAGTAAATCAGGTATGGGTATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002835
VALIDATED
PTPN12 MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase, non-receptor type 12
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002835.3-1619s21c1
Sequence:CCGGCCACCAGAAGAATCCCAGAATCTCGAGATTCTGGGATTCTTCTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002835.3-552s21c1
Sequence:CCGGCCATAACGTTTGCACCATTTACTCGAGTAAATGGTGCAAACGTTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002835.3-820s21c1
Sequence:CCGGCATAGATTATACGTGGAATTTCTCGAGAAATTCCACGTATAATCTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002835.x-245s1c1
Sequence:CCGGCAGCCGAGTTAAATTGACATTCTCGAGAATGTCAATTTAACTCGGCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002835.x-1557s1c1
Sequence:CCGGCCACCAGAAGAATCCCAGAATCTCGAGATTCTGGGATTCTTCTGGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002832    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002835.x-2882s1c1
Sequence:CCGGGCTTTGCAGGTTATCAGAGATCTCGAGATCTCTGATAACCTGCAAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002835.x-427s1c1
Sequence:CCGGGCCGAGAATTTGAGATGGGAACTCGAGTTCCCATCTCAAATTCTCGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002835.x-1659s1c1
Sequence:CCGGGCCATACCCATACCTGATTTACTCGAGTAAATCAGGTATGGGTATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011203
VALIDATED
PTPN12 MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase, non-receptor type 12
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011203.2-754s21c1
Sequence:CCGGGTGGACGAACAGGTGCTATTTCTCGAGAAATAGCACCTGTTCGTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271699    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011203.2-2711s21c1
Sequence:CCGGTACAGGGCAAGTAGGTATATACTCGAGTATATACCTACTTGCCCTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011203.2-405s21c1
Sequence:CCGGAGGATGATATGGGAGTATAATCTCGAGATTATACTCCCATATCATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011203.2-1330s21c1
Sequence:CCGGAGAAGTTAGAGCGCAATTTAACTCGAGTTAAATTGCGCTCTAACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011203.2-1458s21c1
Sequence:CCGGGTAGTTGACAGAACCTCTAAACTCGAGTTTAGAGGTTCTGTCAACTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029879    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011203.2-2476s1c1
Sequence:CCGGGCAGTGTAGATTGTTACCTTACTCGAGTAAGGTAACAATCTACACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011203.2-510s1c1
Sequence:CCGGCCTATAACATTTGCACCATTTCTCGAGAAATGGTGCAAATGTTATAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011203.2-1500s1c1
Sequence:CCGGGCCCTAAAGGTTGATGATGTACTCGAGTACATCATCAACCTTTAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011203.2-657s1c1
Sequence:CCGGCCTTCGTCATTTGATTCTATTCTCGAGAATAGAATCAAATGACGAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011203.2-269s1c1
Sequence:CCGGCCGAGTTAAGTTGACTTTGAACTCGAGTTCAAAGTCAACTTAACTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011203
VALIDATED
PTPN12 MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase, non-receptor type 12
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011203.2-754s21c1
Sequence:CCGGGTGGACGAACAGGTGCTATTTCTCGAGAAATAGCACCTGTTCGTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271699    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011203.2-2711s21c1
Sequence:CCGGTACAGGGCAAGTAGGTATATACTCGAGTATATACCTACTTGCCCTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011203.2-405s21c1
Sequence:CCGGAGGATGATATGGGAGTATAATCTCGAGATTATACTCCCATATCATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011203.2-1330s21c1
Sequence:CCGGAGAAGTTAGAGCGCAATTTAACTCGAGTTAAATTGCGCTCTAACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011203.2-1458s21c1
Sequence:CCGGGTAGTTGACAGAACCTCTAAACTCGAGTTTAGAGGTTCTGTCAACTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029879    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011203.2-2476s1c1
Sequence:CCGGGCAGTGTAGATTGTTACCTTACTCGAGTAAGGTAACAATCTACACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011203.2-510s1c1
Sequence:CCGGCCTATAACATTTGCACCATTTCTCGAGAAATGGTGCAAATGTTATAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011203.2-1500s1c1
Sequence:CCGGGCCCTAAAGGTTGATGATGTACTCGAGTACATCATCAACCTTTAGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011203.2-657s1c1
Sequence:CCGGCCTTCGTCATTTGATTCTATTCTCGAGAATAGAATCAAATGACGAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011203.2-269s1c1
Sequence:CCGGCCGAGTTAAGTTGACTTTGAACTCGAGTTCAAAGTCAACTTAACTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011203
VALIDATED
PTPN12 MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase, non-receptor type 12
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011203.2-754s21c1
Sequence:CCGGGTGGACGAACAGGTGCTATTTCTCGAGAAATAGCACCTGTTCGTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271699    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011203.2-2711s21c1
Sequence:CCGGTACAGGGCAAGTAGGTATATACTCGAGTATATACCTACTTGCCCTGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011203.2-405s21c1
Sequence:CCGGAGGATGATATGGGAGTATAATCTCGAGATTATACTCCCATATCATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011203.2-1330s21c1
Sequence:CCGGAGAAGTTAGAGCGCAATTTAACTCGAGTTAAATTGCGCTCTAACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011203.2-1458s21c1
Sequence:CCGGGTAGTTGACAGAACCTCTAAACTCGAGTTTAGAGGTTCTGTCAACTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029879    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011203.2-2476s1c1
Sequence:CCGGGCAGTGTAGATTGTTACCTTACTCGAGTAAGGTAACAATCTACACTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011203.2-510s1c1
Sequence:CCGGCCTATAACATTTGCACCATTTCTCGAGAAATGGTGCAAATGTTATAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011203.2-1500s1c1
Sequence:CCGGGCCCTAAAGGTTGATGATGTACTCGAGTACATCATCAACCTTTAGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011203.2-657s1c1
Sequence:CCGGCCTTCGTCATTTGATTCTATTCTCGAGAATAGAATCAAATGACGAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011203.2-269s1c1
Sequence:CCGGCCGAGTTAAGTTGACTTTGAACTCGAGTTCAAAGTCAACTTAACTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)