EMAIL THIS PAGE TO A FRIEND

PTPN14

protein tyrosine phosphatase, non-receptor type 14

52 Gene Product Result for
Synonyms: PEZ PTP36
UniProtKB ID: Q15678, Q5VSI0
Gene ID:
Human(5784) Summary: The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an N-terminal noncatalytic domain similar to that of band 4.1 superfamily cytoskeleton-associated proteins, which suggested the membrane or cytoskeleton localization of this protein. It appears to regulate lymphatic development in mammals, and a loss of function mutation has been found in a kindred with a lymphedema-choanal atresia. [provided by RefSeq, Sep 2010]
Mouse(19250) protein tyrosine phosphatase, non-receptor type 14
Rat(305064) protein tyrosine phosphatase, non-receptor type 14
chicken(421360) protein tyrosine phosphatase, non-receptor type 14
domestic cat(101097202) protein tyrosine phosphatase, non-receptor type 14
Horse(100050251) protein tyrosine phosphatase, non-receptor type 14
dog(490293) protein tyrosine phosphatase, non-receptor type 14
cow(518798) protein tyrosine phosphatase, non-receptor type 14
sheep(101112408) protein tyrosine phosphatase, non-receptor type 14
domestic guinea pig(100731586) protein tyrosine phosphatase, non-receptor type 14
naked mole-rat(101720803) protein tyrosine phosphatase, non-receptor type 14
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008976 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008976 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008976 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005401 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005401 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005401 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU054171 MISSION® esiRNA esiRNA human PTPN14 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005401 siRNAs that have been validated in the lab human pricing
NM_001107200 Rosetta Predictions rat pricing
NM_008976 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005401 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127619 validated 1126
1 SASI_Hs01_00127618 validated 3769
1 SASI_Hs01_00127620 validated 3687
2 SASI_Hs01_00127621 predicted 2708
3 SASI_Hs01_00127622 predicted 998
4 SASI_Hs01_00127623 predicted 1455
5 SASI_Hs02_00339526 predicted 522
6 SASI_Hs01_00127624 predicted 1380
7 SASI_Hs01_00127625 predicted 1142
8 SASI_Hs01_00127626 predicted 3757
9 SASI_Hs01_00127627 predicted 2845
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107200 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226495 predicted 1436
2 SASI_Rn02_00226496 predicted 1593
3 SASI_Rn02_00226497 predicted 2868
4 SASI_Rn02_00226498 predicted 1643
5 SASI_Rn02_00226499 predicted 3518
6 SASI_Rn02_00226500 predicted 2628
7 SASI_Rn02_00226501 predicted 2958
8 SASI_Rn02_00226502 predicted 1458
9 SASI_Rn02_00226503 predicted 2634
10 SASI_Rn02_00226504 predicted 3862
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008976 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00029320 predicted 1391
2 SASI_Mm01_00029321 predicted 1783
3 SASI_Mm01_00029322 predicted 3698
4 SASI_Mm01_00029323 predicted 1625
5 SASI_Mm01_00029324 predicted 1016
6 SASI_Mm01_00029326 predicted 880
7 SASI_Mm02_00315058 predicted 1278
8 SASI_Mm02_00315059 predicted 970
9 SASI_Mm01_00029329 predicted 1295
10 SASI_Mm02_00315060 predicted 768
11 SASI_Mm01_00029325 predicted 3527
12 SASI_Mm01_00029327 predicted 766
13 SASI_Mm01_00029328 predicted 738
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008976
PTPN14 MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase, non-receptor type 14
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008976.1-878s1c1
Sequence:CCGGGCAGTGATATACAGGTGGAATCTCGAGATTCCACCTGTATATCACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008976.1-2866s1c1
Sequence:CCGGGTTCACAGAATATGAGCAGATCTCGAGATCTGCTCATATTCTGTGAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008976.1-1799s1c1
Sequence:CCGGGCCCACATGCTCAAGAACTATCTCGAGATAGTTCTTGAGCATGTGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008976.1-3272s1c1
Sequence:CCGGCGGACAGATTCTGGTTGCTATCTCGAGATAGCAACCAGAATCTGTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008976.1-965s1c1
Sequence:CCGGGCGCTCTTCCATACAGATGATCTCGAGATCATCTGTATGGAAGAGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008976
PTPN14 MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase, non-receptor type 14
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008976.1-878s1c1
Sequence:CCGGGCAGTGATATACAGGTGGAATCTCGAGATTCCACCTGTATATCACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008976.1-2866s1c1
Sequence:CCGGGTTCACAGAATATGAGCAGATCTCGAGATCTGCTCATATTCTGTGAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008976.1-1799s1c1
Sequence:CCGGGCCCACATGCTCAAGAACTATCTCGAGATAGTTCTTGAGCATGTGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008976.1-3272s1c1
Sequence:CCGGCGGACAGATTCTGGTTGCTATCTCGAGATAGCAACCAGAATCTGTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008976.1-965s1c1
Sequence:CCGGGCGCTCTTCCATACAGATGATCTCGAGATCATCTGTATGGAAGAGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008976
PTPN14 MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase, non-receptor type 14
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008976.1-878s1c1
Sequence:CCGGGCAGTGATATACAGGTGGAATCTCGAGATTCCACCTGTATATCACTGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000029018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008976.1-2866s1c1
Sequence:CCGGGTTCACAGAATATGAGCAGATCTCGAGATCTGCTCATATTCTGTGAACTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000029015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008976.1-1799s1c1
Sequence:CCGGGCCCACATGCTCAAGAACTATCTCGAGATAGTTCTTGAGCATGTGGGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000029016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008976.1-3272s1c1
Sequence:CCGGCGGACAGATTCTGGTTGCTATCTCGAGATAGCAACCAGAATCTGTCCGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000029017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008976.1-965s1c1
Sequence:CCGGGCGCTCTTCCATACAGATGATCTCGAGATCATCTGTATGGAAGAGCGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005401
VALIDATED
PTPN14 MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase, non-receptor type 14
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005401.3-3772s1c1
Sequence:CCGGCGCTCAGTACAAGTTTGTCTACTCGAGTAGACAAACTTGTACTGAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006889    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005401.3-3887s1c1
Sequence:CCGGAGAGTCACCTCCAGACAACATCTCGAGATGTTGTCTGGAGGTGACTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005401.3-1016s1c1
Sequence:CCGGGCGGTAATATACAGGTGGAATCTCGAGATTCCACCTGTATATTACCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005401.3-2912s1c1
Sequence:CCGGCGGGAAGAGAATCGAGTTGATCTCGAGATCAACTCGATTCTCTTCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005401.3-754s1c1
Sequence:CCGGCCTCAGAGAGTATGTGCTATTCTCGAGAATAGCACATACTCTCTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005401.3-606s21c1
Sequence:CCGGAGGCCACAAGATATCAGTATTCTCGAGAATACTGATATCTTGTGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005401.3-644s21c1
Sequence:CCGGGATGTGCTTGAAGGGCGATTACTCGAGTAATCGCCCTTCAAGCACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005401.3-3768s21c1
Sequence:CCGGCTATCGCTCAGTACAAGTTTGCTCGAGCAAACTTGTACTGAGCGATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005401.3-524s21c1
Sequence:CCGGCATCTGGACAAATTCGCTAATCTCGAGATTAGCGAATTTGTCCAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005401.3-1005s21c1
Sequence:CCGGTTGGAAGACAAGCGGTAATATCTCGAGATATTACCGCTTGTCTTCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005401.3-438s21c1
Sequence:CCGGTGCGAGAGACGCACTACTTTGCTCGAGCAAAGTAGTGCGTCTCTCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005401.3-3682s21c1
Sequence:GTACCGGGATCTACTGCTTGGAACATAACTCGAGTTATGTTCCAAGCAGTAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005401.3-3890s21c1
Sequence:CCGGGTCACCTCCAGACAACATCTGCTCGAGCAGATGTTGTCTGGAGGTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005401
VALIDATED
PTPN14 MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase, non-receptor type 14
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005401.3-3772s1c1
Sequence:CCGGCGCTCAGTACAAGTTTGTCTACTCGAGTAGACAAACTTGTACTGAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006889    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005401.3-3887s1c1
Sequence:CCGGAGAGTCACCTCCAGACAACATCTCGAGATGTTGTCTGGAGGTGACTCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005401.3-1016s1c1
Sequence:CCGGGCGGTAATATACAGGTGGAATCTCGAGATTCCACCTGTATATTACCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005401.3-2912s1c1
Sequence:CCGGCGGGAAGAGAATCGAGTTGATCTCGAGATCAACTCGATTCTCTTCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005401.3-754s1c1
Sequence:CCGGCCTCAGAGAGTATGTGCTATTCTCGAGAATAGCACATACTCTCTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005401.3-606s21c1
Sequence:CCGGAGGCCACAAGATATCAGTATTCTCGAGAATACTGATATCTTGTGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005401.3-644s21c1
Sequence:CCGGGATGTGCTTGAAGGGCGATTACTCGAGTAATCGCCCTTCAAGCACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005401.3-3768s21c1
Sequence:CCGGCTATCGCTCAGTACAAGTTTGCTCGAGCAAACTTGTACTGAGCGATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005401.3-524s21c1
Sequence:CCGGCATCTGGACAAATTCGCTAATCTCGAGATTAGCGAATTTGTCCAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005401.3-1005s21c1
Sequence:CCGGTTGGAAGACAAGCGGTAATATCTCGAGATATTACCGCTTGTCTTCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005401.3-438s21c1
Sequence:CCGGTGCGAGAGACGCACTACTTTGCTCGAGCAAAGTAGTGCGTCTCTCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005401.3-3682s21c1
Sequence:GTACCGGGATCTACTGCTTGGAACATAACTCGAGTTATGTTCCAAGCAGTAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005401.3-3890s21c1
Sequence:CCGGGTCACCTCCAGACAACATCTGCTCGAGCAGATGTTGTCTGGAGGTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005401
VALIDATED
PTPN14 MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase, non-receptor type 14
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005401.3-3772s1c1
Sequence:CCGGCGCTCAGTACAAGTTTGTCTACTCGAGTAGACAAACTTGTACTGAGCGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000006889    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005401.3-3887s1c1
Sequence:CCGGAGAGTCACCTCCAGACAACATCTCGAGATGTTGTCTGGAGGTGACTCTTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000006890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005401.3-1016s1c1
Sequence:CCGGGCGGTAATATACAGGTGGAATCTCGAGATTCCACCTGTATATTACCGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000006891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005401.3-2912s1c1
Sequence:CCGGCGGGAAGAGAATCGAGTTGATCTCGAGATCAACTCGATTCTCTTCCCGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000006893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005401.3-754s1c1
Sequence:CCGGCCTCAGAGAGTATGTGCTATTCTCGAGAATAGCACATACTCTCTGAGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000356151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005401.3-606s21c1
Sequence:CCGGAGGCCACAAGATATCAGTATTCTCGAGAATACTGATATCTTGTGGCCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000367553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005401.3-644s21c1
Sequence:CCGGGATGTGCTTGAAGGGCGATTACTCGAGTAATCGCCCTTCAAGCACATCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000226416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005401.3-3768s21c1
Sequence:CCGGCTATCGCTCAGTACAAGTTTGCTCGAGCAAACTTGTACTGAGCGATAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000356150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005401.3-524s21c1
Sequence:CCGGCATCTGGACAAATTCGCTAATCTCGAGATTAGCGAATTTGTCCAGATGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000226415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005401.3-1005s21c1
Sequence:CCGGTTGGAAGACAAGCGGTAATATCTCGAGATATTACCGCTTGTCTTCCAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000226414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005401.3-438s21c1
Sequence:CCGGTGCGAGAGACGCACTACTTTGCTCGAGCAAAGTAGTGCGTCTCTCGCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000218796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005401.3-3682s21c1
Sequence:GTACCGGGATCTACTGCTTGGAACATAACTCGAGTTATGTTCCAAGCAGTAGATCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000226417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005401.3-3890s21c1
Sequence:CCGGGTCACCTCCAGACAACATCTGCTCGAGCAGATGTTGTCTGGAGGTGACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???