EMAIL THIS PAGE TO A FRIEND

PTPN1

protein tyrosine phosphatase, non-receptor type 1

174 Gene Product Result for
Synonyms: PTP1B
UniProtKB ID: P18031, Q5TGD8, Q9BQV9, Q9NQQ4
Gene ID:
Human(5770) Summary: The protein encoded by this gene is the founding member of the protein tyrosine phosphatase (PTP) family, which was isolated and identified based on its enzymatic activity and amino acid sequence. PTPs catalyze the hydrolysis of the phosphate monoesters specifically on tyrosine residues. Members of the PTP family share a highly conserved catalytic motif, which is essential for the catalytic activity. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP has been shown to act as a negative regulator of insulin signaling by dephosphorylating the phosphotryosine residues of insulin receptor kinase. This PTP was also reported to dephosphorylate epidermal growth factor receptor kinase, as well as JAK2 and TYK2 kinases, which implicated the role of this PTP in cell growth control, and cell response to interferon stimulation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2013]
Mouse(19246) protein tyrosine phosphatase, non-receptor type 1
Rat(24697) protein tyrosine phosphatase, non-receptor type 1
cow(508658) protein tyrosine phosphatase, non-receptor type 1
sheep(101118209) protein tyrosine phosphatase, non-receptor type 1
domestic guinea pig(100730699) protein tyrosine phosphatase, non-receptor type 1
naked mole-rat(101696680) protein tyrosine phosphatase, non-receptor type 1
Domestic Rabbit(100354834) protein tyrosine phosphatase, non-receptor type 1
Zebrafish(30081) protein tyrosine phosphatase, non-receptor type 1
Horse(100052066) protein tyrosine phosphatase, non-receptor type 1
domestic cat(101099626) protein tyrosine phosphatase, non-receptor type 1
dog(477263) protein tyrosine phosphatase, non-receptor type 1
chicken(395688) protein tyrosine phosphatase, non-receptor type 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4504105 Anti-phospho-PTP1B (pSer50) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4301535 Anti-phospho-PTP1B (pSer50) antibody produced in rabbit affinity isolated antibody rat, monkey, human, mouse
western blot pricing
SAB1306059 ANTI-PTP1B (N-TERMINAL) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB4502525 Anti-PTP1B antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB1306060 ANTI-PTP1B antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
western blot pricing
GW21488 Anti-PTPN1 antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB1406342 Anti-PTPN1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA012542 Anti-PTPN1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
AV45360 Anti-PTPN1 antibody produced in rabbit affinity isolated antibody mouse, zebrafish, rat, bovine, horse, guinea pig, human, pig, rabbit, canine
western blot pricing
SAB1411155 Anti-PTPN1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB1305532 MONOCLONAL ANTI-PTP1B antibody produced in mouse clone 107AT690, IgG fraction of antiserum, buffered aqueous solution human, mouse
western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
523763 2,6-Naphthalenedicarboxylic acid 99% Green Alternative human pricing
301353 2,6-Naphthalenedicarboxylic acid 95% human pricing
402028 2-Amino-3-formylchromone 97% human pricing
633704 3-(4-Bromophenyl)-1H-pyrazole-5-carboxylic acid 97% human pricing
402141 3-Formyl-6-isopropylchromone 99% human pricing
402192 3-Formyl-6-nitrochromone 99% human pricing
383449 3-Formylchromone 97% human pricing
A79604 4-Aminosalicylic acid 99% human pricing
189782 4-Oxo-4H-1-benzopyran-2-carboxylic acid 97% human pricing
645001 5-(4-Bromophenyl)isoxazole-3-carboxylic acid 95% human pricing
402176 6,8-Dibromo-3-formylchromone 99% human pricing
402168 6-Bromo-3-formylchromone 99% human pricing
402184 6-Chloro-3-formyl-7-methylchromone 98% human pricing
543624 6-Fluorochromone-3-carboxaldehyde 97% human pricing
156507 9,10-Phenanthrenequinone ≥99% human pricing
275034 9,10-Phenanthrenequinone 95% human pricing
458848 Allura Red AC Dye content 80 % human pricing
532576 Chromone-3-carboxylic acid 97% human pricing
C85603 Coumarin-3-carboxylic acid 99% human pricing
C0644 Crystal Ponceau 6R human pricing
E2129 Evans Blue Dye content ≥75 % human pricing
46955 Fluorescein for fluorescence, free acid human pricing
M9440 Methyl-3,4-dephostatin >98% (HPLC), powder human pricing
N7537 NSC 663284 ≥98% (HPLC), solid human pricing
45150 Pamoic acid ≥97.0% (T) human pricing
S5922 Salicylic acid BioXtra, ≥99.0% human pricing
S7401 Salicylic acid plant cell culture tested human pricing
247588 Salicylic acid ACS reagent, ≥99.0% human pricing
84210 Salicylic acid puriss. p.a., ≥99.0% (T) human pricing
27301 Salicylic acid meets analytical specification of Ph. Eur., BP, USP, 99.5-100.5% (calc. to the dried substance) human pricing
105910 Salicylic acid ReagentPlus®, ≥99% human pricing
W398500 Salicylic acid ≥99%, FG human pricing
302643 Trypan Blue Dye content 60 % human pricing
T6146 Trypan Blue powder, BioReagent, suitable for cell culture human pricing

ELISA

Product # Description Species Add to Cart
 
RAB1657 Human PTP1B ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002827 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002827 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002827 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011201 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011201 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011201 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002827 siRNAs that have been validated in the lab human pricing
NM_012637 Rosetta Predictions rat pricing
NM_011201 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002827 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230698 validated 1456
1 SASI_Hs01_00230697 validated 880
1 SASI_Hs01_00230699 validated 321
2 SASI_Hs02_00334527 predicted 674
3 SASI_Hs01_00230700 predicted 1473
4 SASI_Hs02_00334528 predicted 616
5 SASI_Hs02_00334529 predicted 407
6 SASI_Hs01_00230706 predicted 224
7 SASI_Hs02_00334530 predicted 1257
8 SASI_Hs02_00334531 predicted 1257
9 SASI_Hs01_00230701 predicted 1448
10 SASI_Hs01_00230702 predicted 998
11 SASI_Hs01_00230703 predicted 980
12 SASI_Hs01_00230704 predicted 1258
13 SASI_Hs01_00230705 predicted 309
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012637 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118176 predicted 509
2 SASI_Rn01_00118177 predicted 1135
3 SASI_Rn01_00118178 predicted 1419
4 SASI_Rn01_00118179 predicted 892
5 SASI_Rn01_00118180 predicted 240
6 SASI_Rn01_00118181 predicted 1343
7 SASI_Rn01_00118182 predicted 1158
8 SASI_Rn01_00118183 predicted 643
9 SASI_Rn01_00118184 predicted 1017
10 SASI_Rn01_00118185 predicted 904
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011201 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00071283 predicted 992
2 SASI_Mm01_00071284 predicted 214
3 SASI_Mm01_00071285 predicted 1119
4 SASI_Mm02_00320129 predicted 333
5 SASI_Mm01_00071286 predicted 599
6 SASI_Mm01_00071287 predicted 649
7 SASI_Mm02_00320130 predicted 667
8 SASI_Mm01_00071289 predicted 608
9 SASI_Mm01_00071290 predicted 350
10 SASI_Mm01_00071291 predicted 978
11 SASI_Mm01_00071288 predicted 899
12 SASI_Mm01_00071292 predicted 784
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002827
VALIDATED
PTPN1 MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase, non-receptor type 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002827.2-992s21c1
Sequence:CCGGCTGTGATCGAAGGTGCCAAATCTCGAGATTTGGCACCTTCGATCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002827.2-328s21c1
Sequence:CCGGTTTGACCATAGTCGGATTAAACTCGAGTTTAATCCGACTATGGTCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002827.2-400s21c1
Sequence:CCGGGAAGCCCAAAGGAGTTACATTCTCGAGAATGTAACTCCTTTGGGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002827.2-638s21c1
Sequence:CCGGTGCGACAGCTAGAATTGGAAACTCGAGTTTCCAATTCTAGCTGTCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320590    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002827.2-3232s21c1
Sequence:CCGGGCTGCTCTGCTATATGCCTTACTCGAGTAAGGCATATAGCAGAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A-431
TRC Version: 1 Clone ID:NM_002827.x-992s1c1
Sequence:CCGGCTGTGATCGAAGGTGCCAAATCTCGAGATTTGGCACCTTCGATCACAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002777    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A-431
TRC Version: 1 Clone ID:NM_002827.x-3232s1c1
Sequence:CCGGGCTGCTCTGCTATATGCCTTACTCGAGTAAGGCATATAGCAGAGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002827.x-439s1c1
Sequence:CCGGCCTAACACATGCGGTCACTTTCTCGAGAAAGTGACCGCATGTGTTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002827.x-638s1c1
Sequence:CCGGTGCGACAGCTAGAATTGGAAACTCGAGTTTCCAATTCTAGCTGTCGCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002827.x-400s1c1
Sequence:CCGGGAAGCCCAAAGGAGTTACATTCTCGAGAATGTAACTCCTTTGGGCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002827
VALIDATED
PTPN1 MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase, non-receptor type 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002827.2-992s21c1
Sequence:CCGGCTGTGATCGAAGGTGCCAAATCTCGAGATTTGGCACCTTCGATCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002827.2-328s21c1
Sequence:CCGGTTTGACCATAGTCGGATTAAACTCGAGTTTAATCCGACTATGGTCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002827.2-400s21c1
Sequence:CCGGGAAGCCCAAAGGAGTTACATTCTCGAGAATGTAACTCCTTTGGGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002827.2-638s21c1
Sequence:CCGGTGCGACAGCTAGAATTGGAAACTCGAGTTTCCAATTCTAGCTGTCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320590    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002827.2-3232s21c1
Sequence:CCGGGCTGCTCTGCTATATGCCTTACTCGAGTAAGGCATATAGCAGAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A-431
TRC Version: 1 Clone ID:NM_002827.x-992s1c1
Sequence:CCGGCTGTGATCGAAGGTGCCAAATCTCGAGATTTGGCACCTTCGATCACAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002777    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A-431
TRC Version: 1 Clone ID:NM_002827.x-3232s1c1
Sequence:CCGGGCTGCTCTGCTATATGCCTTACTCGAGTAAGGCATATAGCAGAGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002827.x-439s1c1
Sequence:CCGGCCTAACACATGCGGTCACTTTCTCGAGAAAGTGACCGCATGTGTTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002827.x-638s1c1
Sequence:CCGGTGCGACAGCTAGAATTGGAAACTCGAGTTTCCAATTCTAGCTGTCGCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002827.x-400s1c1
Sequence:CCGGGAAGCCCAAAGGAGTTACATTCTCGAGAATGTAACTCCTTTGGGCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002827
VALIDATED
PTPN1 MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase, non-receptor type 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002827.2-992s21c1
Sequence:CCGGCTGTGATCGAAGGTGCCAAATCTCGAGATTTGGCACCTTCGATCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002827.2-328s21c1
Sequence:CCGGTTTGACCATAGTCGGATTAAACTCGAGTTTAATCCGACTATGGTCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002827.2-400s21c1
Sequence:CCGGGAAGCCCAAAGGAGTTACATTCTCGAGAATGTAACTCCTTTGGGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002827.2-638s21c1
Sequence:CCGGTGCGACAGCTAGAATTGGAAACTCGAGTTTCCAATTCTAGCTGTCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320590    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002827.2-3232s21c1
Sequence:CCGGGCTGCTCTGCTATATGCCTTACTCGAGTAAGGCATATAGCAGAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A-431
TRC Version: 1 Clone ID:NM_002827.x-992s1c1
Sequence:CCGGCTGTGATCGAAGGTGCCAAATCTCGAGATTTGGCACCTTCGATCACAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002777    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A-431
TRC Version: 1 Clone ID:NM_002827.x-3232s1c1
Sequence:CCGGGCTGCTCTGCTATATGCCTTACTCGAGTAAGGCATATAGCAGAGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002827.x-439s1c1
Sequence:CCGGCCTAACACATGCGGTCACTTTCTCGAGAAAGTGACCGCATGTGTTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002827.x-638s1c1
Sequence:CCGGTGCGACAGCTAGAATTGGAAACTCGAGTTTCCAATTCTAGCTGTCGCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002827.x-400s1c1
Sequence:CCGGGAAGCCCAAAGGAGTTACATTCTCGAGAATGTAACTCCTTTGGGCTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011201
VALIDATED
PTPN1 MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase, non-receptor type 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218522    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011201.3-3928s21c1
Sequence:GTACCGGGTATGCCTTAAGTCAACATTTCTCGAGAAATGTTGACTTAAGGCATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011201.3-729s21c1
Sequence:CCGGCCGGCTTCTTTCCTCAATTTCCTCGAGGAAATTGAGGAAAGAAGCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011201.3-506s21c1
Sequence:CCGGCATGGAGAAAGGCTCGTTAAACTCGAGTTTAACGAGCCTTTCTCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011201.3-393s21c1
Sequence:CCGGGAAGCCCAGAGGAGCTATATTCTCGAGAATATAGCTCCTCTGGGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011201.3-321s21c1
Sequence:CCGGTTTGACCACAGTCGGATTAAACTCGAGTTTAATCCGACTGTGGTCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011201.1-875s1c1
Sequence:CCGGCGGATTAAATTGCACCAGGAACTCGAGTTCCTGGTGCAATTTAATCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011201.1-1399s1c1
Sequence:CCGGCTGCCTCTTACTGATGGACAACTCGAGTTGTCCATCAGTAAGAGGCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011201.1-1172s1c1
Sequence:CCGGGTACGACAGTTGGAGTTGGAACTCGAGTTCCAACTCCAACTGTCGTACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011201.1-758s1c1
Sequence:CCGGGCGGCTATTTACCAGGACATTCTCGAGAATGTCCTGGTAAATAGCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011201.1-1807s1c1
Sequence:CCGGCACTGAAGTTAGGAGACGGATCTCGAGATCCGTCTCCTAACTTCAGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011201
VALIDATED
PTPN1 MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase, non-receptor type 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218522    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011201.3-3928s21c1
Sequence:GTACCGGGTATGCCTTAAGTCAACATTTCTCGAGAAATGTTGACTTAAGGCATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011201.3-729s21c1
Sequence:CCGGCCGGCTTCTTTCCTCAATTTCCTCGAGGAAATTGAGGAAAGAAGCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011201.3-506s21c1
Sequence:CCGGCATGGAGAAAGGCTCGTTAAACTCGAGTTTAACGAGCCTTTCTCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011201.3-393s21c1
Sequence:CCGGGAAGCCCAGAGGAGCTATATTCTCGAGAATATAGCTCCTCTGGGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011201.3-321s21c1
Sequence:CCGGTTTGACCACAGTCGGATTAAACTCGAGTTTAATCCGACTGTGGTCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011201.1-875s1c1
Sequence:CCGGCGGATTAAATTGCACCAGGAACTCGAGTTCCTGGTGCAATTTAATCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011201.1-1399s1c1
Sequence:CCGGCTGCCTCTTACTGATGGACAACTCGAGTTGTCCATCAGTAAGAGGCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011201.1-1172s1c1
Sequence:CCGGGTACGACAGTTGGAGTTGGAACTCGAGTTCCAACTCCAACTGTCGTACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011201.1-758s1c1
Sequence:CCGGGCGGCTATTTACCAGGACATTCTCGAGAATGTCCTGGTAAATAGCCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011201.1-1807s1c1
Sequence:CCGGCACTGAAGTTAGGAGACGGATCTCGAGATCCGTCTCCTAACTTCAGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011201
VALIDATED
PTPN1 MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase, non-receptor type 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218522    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011201.3-3928s21c1
Sequence:GTACCGGGTATGCCTTAAGTCAACATTTCTCGAGAAATGTTGACTTAAGGCATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011201.3-729s21c1
Sequence:CCGGCCGGCTTCTTTCCTCAATTTCCTCGAGGAAATTGAGGAAAGAAGCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011201.3-506s21c1
Sequence:CCGGCATGGAGAAAGGCTCGTTAAACTCGAGTTTAACGAGCCTTTCTCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011201.3-393s21c1
Sequence:CCGGGAAGCCCAGAGGAGCTATATTCTCGAGAATATAGCTCCTCTGGGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011201.3-321s21c1
Sequence:CCGGTTTGACCACAGTCGGATTAAACTCGAGTTTAATCCGACTGTGGTCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011201.1-875s1c1
Sequence:CCGGCGGATTAAATTGCACCAGGAACTCGAGTTCCTGGTGCAATTTAATCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011201.1-1399s1c1
Sequence:CCGGCTGCCTCTTACTGATGGACAACTCGAGTTGTCCATCAGTAAGAGGCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011201.1-1172s1c1
Sequence:CCGGGTACGACAGTTGGAGTTGGAACTCGAGTTCCAACTCCAACTGTCGTACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011201.1-758s1c1
Sequence:CCGGGCGGCTATTTACCAGGACATTCTCGAGAATGTCCTGGTAAATAGCCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011201.1-1807s1c1
Sequence:CCGGCACTGAAGTTAGGAGACGGATCTCGAGATCCGTCTCCTAACTTCAGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)