EMAIL THIS PAGE TO A FRIEND

PTPN21

protein tyrosine phosphatase, non-receptor type 21

84 Gene Product Result for
Synonyms: PTPD1 PTPRL10
UniProtKB ID: Q16825
Gene ID:
Human(11099) Summary: The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an N-terminal domain, similar to cytoskeletal- associated proteins including band 4.1, ezrin, merlin, and radixin. This PTP was shown to specially interact with BMX/ETK, a member of Tec tyrosine kinase family characterized by a multimodular structures including PH, SH3, and SH2 domains. The interaction of this PTP with BMX kinase was found to increase the activation of STAT3, but not STAT2 kinase. Studies of the similar gene in mice suggested the possible roles of this PTP in liver regeneration and spermatogenesis. [provided by RefSeq, Jul 2008]
Mouse(24000) protein tyrosine phosphatase, non-receptor type 21
Rat(171070) protein tyrosine phosphatase, non-receptor type 21
Zebrafish(799627) protein tyrosine phosphatase, non-receptor type 21
domestic cat(101084369) protein tyrosine phosphatase, non-receptor type 21
Horse(100062018) protein tyrosine phosphatase, non-receptor type 21
dog(490823) protein tyrosine phosphatase, non-receptor type 21
chicken(423398) protein tyrosine phosphatase, non-receptor type 21
domestic guinea pig(100723000) protein tyrosine phosphatase, non-receptor type 21
naked mole-rat(101720006) protein tyrosine phosphatase, non-receptor type 21
cow(520178) protein tyrosine phosphatase, non-receptor type 21
sheep(101113938) protein tyrosine phosphatase, non-receptor type 21
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011877 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011877 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011877 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007039 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007039 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007039 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU017461 MISSION® esiRNA esiRNA targeting human PTPN21 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007039 Rosetta Predictions human pricing
NM_133545 Rosetta Predictions rat pricing
NM_011877 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007039 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00342817 predicted 3291
2 SASI_Hs01_00060304 predicted 760
3 SASI_Hs01_00060305 predicted 1130
4 SASI_Hs02_00342818 predicted 3192
5 SASI_Hs01_00060307 predicted 713
6 SASI_Hs01_00060308 predicted 1287
7 SASI_Hs01_00060309 predicted 601
8 SASI_Hs01_00060310 predicted 1375
9 SASI_Hs01_00060312 predicted 3583
10 SASI_Hs02_00342819 predicted 1363
11 SASI_Hs01_00060306 predicted 1679
12 SASI_Hs01_00060311 predicted 1369
13 SASI_Hs01_00060313 predicted 787
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133545 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00097689 predicted 1064
2 SASI_Rn01_00097691 predicted 3519
3 SASI_Rn01_00097692 predicted 1030
4 SASI_Rn01_00097693 predicted 552
5 SASI_Rn02_00267732 predicted 3277
6 SASI_Rn01_00097694 predicted 3427
7 SASI_Rn01_00097697 predicted 3145
8 SASI_Rn01_00097698 predicted 1349
9 SASI_Rn02_00267733 predicted 1521
10 SASI_Rn02_00267734 predicted 650
11 SASI_Rn01_00097690 predicted 1456
12 SASI_Rn01_00097695 predicted 680
13 SASI_Rn01_00097696 predicted 2162
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011877 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00189279 predicted 3895
2 SASI_Mm01_00189280 predicted 1332
3 SASI_Mm01_00189281 predicted 589
4 SASI_Mm01_00189282 predicted 1482
5 SASI_Mm01_00189283 predicted 3190
6 SASI_Mm02_00321668 predicted 755
7 SASI_Mm01_00189285 predicted 936
8 SASI_Mm01_00189286 predicted 3174
9 SASI_Mm01_00189287 predicted 1648
10 SASI_Mm01_00189288 predicted 693
11 SASI_Mm01_00189284 predicted 1081
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011877
VALIDATED
PTPN21 MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase, non-receptor type 21
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011877.1-3195s1c1
Sequence:CCGGCGGAATAGAATGGGATTATATCTCGAGATATAATCCCATTCTATTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011877.1-1012s1c1
Sequence:CCGGGCCTGTCTCGATGGTATCTTTCTCGAGAAAGATACCATCGAGACAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011877.1-1114s1c1
Sequence:CCGGGCACTAGAGCTGGCAAATAAACTCGAGTTTATTTGCCAGCTCTAGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011877.1-1728s1c1
Sequence:CCGGCCTCAACATTGGCAGTTCCTACTCGAGTAGGAACTGCCAATGTTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011877.1-2516s1c1
Sequence:CCGGCCGCTTTCTCTCAGGAACTAACTCGAGTTAGTTCCTGAGAGAAAGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011877.1-1728s21c1
Sequence:CCGGCCTCAACATTGGCAGTTCCTACTCGAGTAGGAACTGCCAATGTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011877.1-2516s21c1
Sequence:CCGGCCGCTTTCTCTCAGGAACTAACTCGAGTTAGTTCCTGAGAGAAAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011877.1-1114s21c1
Sequence:CCGGGCACTAGAGCTGGCAAATAAACTCGAGTTTATTTGCCAGCTCTAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011877.1-3195s21c1
Sequence:CCGGCGGAATAGAATGGGATTATATCTCGAGATATAATCCCATTCTATTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011877
VALIDATED
PTPN21 MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase, non-receptor type 21
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011877.1-3195s1c1
Sequence:CCGGCGGAATAGAATGGGATTATATCTCGAGATATAATCCCATTCTATTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011877.1-1012s1c1
Sequence:CCGGGCCTGTCTCGATGGTATCTTTCTCGAGAAAGATACCATCGAGACAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011877.1-1114s1c1
Sequence:CCGGGCACTAGAGCTGGCAAATAAACTCGAGTTTATTTGCCAGCTCTAGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011877.1-1728s1c1
Sequence:CCGGCCTCAACATTGGCAGTTCCTACTCGAGTAGGAACTGCCAATGTTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011877.1-2516s1c1
Sequence:CCGGCCGCTTTCTCTCAGGAACTAACTCGAGTTAGTTCCTGAGAGAAAGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011877.1-1728s21c1
Sequence:CCGGCCTCAACATTGGCAGTTCCTACTCGAGTAGGAACTGCCAATGTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011877.1-2516s21c1
Sequence:CCGGCCGCTTTCTCTCAGGAACTAACTCGAGTTAGTTCCTGAGAGAAAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011877.1-1114s21c1
Sequence:CCGGGCACTAGAGCTGGCAAATAAACTCGAGTTTATTTGCCAGCTCTAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011877.1-3195s21c1
Sequence:CCGGCGGAATAGAATGGGATTATATCTCGAGATATAATCCCATTCTATTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011877
VALIDATED
PTPN21 MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase, non-receptor type 21
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011877.1-3195s1c1
Sequence:CCGGCGGAATAGAATGGGATTATATCTCGAGATATAATCCCATTCTATTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011877.1-1012s1c1
Sequence:CCGGGCCTGTCTCGATGGTATCTTTCTCGAGAAAGATACCATCGAGACAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011877.1-1114s1c1
Sequence:CCGGGCACTAGAGCTGGCAAATAAACTCGAGTTTATTTGCCAGCTCTAGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011877.1-1728s1c1
Sequence:CCGGCCTCAACATTGGCAGTTCCTACTCGAGTAGGAACTGCCAATGTTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011877.1-2516s1c1
Sequence:CCGGCCGCTTTCTCTCAGGAACTAACTCGAGTTAGTTCCTGAGAGAAAGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011877.1-1728s21c1
Sequence:CCGGCCTCAACATTGGCAGTTCCTACTCGAGTAGGAACTGCCAATGTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011877.1-2516s21c1
Sequence:CCGGCCGCTTTCTCTCAGGAACTAACTCGAGTTAGTTCCTGAGAGAAAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011877.1-1114s21c1
Sequence:CCGGGCACTAGAGCTGGCAAATAAACTCGAGTTTATTTGCCAGCTCTAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011877.1-3195s21c1
Sequence:CCGGCGGAATAGAATGGGATTATATCTCGAGATATAATCCCATTCTATTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007039
VALIDATED
PTPN21 MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase, non-receptor type 21
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001874    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_007039.x-3915s1c1
Sequence:CCGGGCGCTTGCCTAACTCATACTTCTCGAGAAGTATGAGTTAGGCAAGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_007039.x-2965s1c1
Sequence:CCGGCAACGAATGATGAAAGGTGTACTCGAGTACACCTTTCATCATTCGTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_007039.x-894s1c1
Sequence:CCGGGTGGCCTTACTACATCAGAAACTCGAGTTTCTGATGTAGTAAGGCCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007039.x-3595s1c1
Sequence:CCGGGACGCCATACAAATAGCACAACTCGAGTTGTGCTATTTGTATGGCGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007039.x-1526s1c1
Sequence:CCGGCAGCACCAACTCCTTAAATAACTCGAGTTATTTAAGGAGTTGGTGCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007039.3-1355s21c1
Sequence:CCGGCCACCGCAGTTGCACTATAATCTCGAGATTATAGTGCAACTGCGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355659    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007039.3-4312s21c1
Sequence:CCGGGATATGAGTTGCTCCTATATACTCGAGTATATAGGAGCAACTCATATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007039
VALIDATED
PTPN21 MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase, non-receptor type 21
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001874    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_007039.x-3915s1c1
Sequence:CCGGGCGCTTGCCTAACTCATACTTCTCGAGAAGTATGAGTTAGGCAAGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_007039.x-2965s1c1
Sequence:CCGGCAACGAATGATGAAAGGTGTACTCGAGTACACCTTTCATCATTCGTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_007039.x-894s1c1
Sequence:CCGGGTGGCCTTACTACATCAGAAACTCGAGTTTCTGATGTAGTAAGGCCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007039.x-3595s1c1
Sequence:CCGGGACGCCATACAAATAGCACAACTCGAGTTGTGCTATTTGTATGGCGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007039.x-1526s1c1
Sequence:CCGGCAGCACCAACTCCTTAAATAACTCGAGTTATTTAAGGAGTTGGTGCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007039.3-1355s21c1
Sequence:CCGGCCACCGCAGTTGCACTATAATCTCGAGATTATAGTGCAACTGCGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355659    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007039.3-4312s21c1
Sequence:CCGGGATATGAGTTGCTCCTATATACTCGAGTATATAGGAGCAACTCATATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007039
VALIDATED
PTPN21 MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase, non-receptor type 21
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001874    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_007039.x-3915s1c1
Sequence:CCGGGCGCTTGCCTAACTCATACTTCTCGAGAAGTATGAGTTAGGCAAGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_007039.x-2965s1c1
Sequence:CCGGCAACGAATGATGAAAGGTGTACTCGAGTACACCTTTCATCATTCGTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_007039.x-894s1c1
Sequence:CCGGGTGGCCTTACTACATCAGAAACTCGAGTTTCTGATGTAGTAAGGCCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007039.x-3595s1c1
Sequence:CCGGGACGCCATACAAATAGCACAACTCGAGTTGTGCTATTTGTATGGCGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007039.x-1526s1c1
Sequence:CCGGCAGCACCAACTCCTTAAATAACTCGAGTTATTTAAGGAGTTGGTGCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007039.3-1355s21c1
Sequence:CCGGCCACCGCAGTTGCACTATAATCTCGAGATTATAGTGCAACTGCGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355659    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007039.3-4312s21c1
Sequence:CCGGGATATGAGTTGCTCCTATATACTCGAGTATATAGGAGCAACTCATATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)