EMAIL THIS PAGE TO A FRIEND

PTPN22

protein tyrosine phosphatase, non-receptor type 22 (lymphoid)

83 Gene Product Result for
Synonyms: LYP LYP1 LYP2 PEP PTPN8
Gene ID:
Human(26191) Summary: This gene encodes of member of the non-receptor class 4 subfamily of the protein-tyrosine phosphatase family. The encoded protein is a lymphoid-specific intracellular phosphatase that associates with the molecular adapter protein CBL and may be involved in regulating CBL function in the T-cell receptor signaling pathway. Mutations in this gene may be associated with a range of autoimmune disorders including Type 1 Diabetes, rheumatoid arthritis, systemic lupus erythematosus and Graves' disease. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Mar 2009]
Mouse(19260) protein tyrosine phosphatase, non-receptor type 22 (lymphoid)
Rat(295338) protein tyrosine phosphatase, non-receptor type 22 (lymphoid)
cow(518992) protein tyrosine phosphatase, non-receptor type 22 (lymphoid)
sheep(101119860) protein tyrosine phosphatase, non-receptor type 22 (lymphoid)
naked mole-rat(101711810) protein tyrosine phosphatase, non-receptor type 22 (lymphoid)
Domestic Rabbit(100354293) protein tyrosine phosphatase, non-receptor type 22 (lymphoid)
domestic guinea pig(100717611) protein tyrosine phosphatase, non-receptor type 22 (lymphoid)
Zebrafish(565606) protein tyrosine phosphatase, non-receptor type 22
domestic cat(101099820) protein tyrosine phosphatase, non-receptor type 22 (lymphoid)
dog(483124) protein tyrosine phosphatase, non-receptor type 22 (lymphoid)
chicken(772032) protein tyrosine phosphatase, non-receptor type 22 (lymphoid)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012411 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012411 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012411 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008979 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008979 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008979 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012411 Rosetta Predictions human pricing
NM_015967 Rosetta Predictions human pricing
NM_001106460 Rosetta Predictions rat pricing
NM_008979 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012411 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099391 predicted 1590
2 SASI_Hs01_00099392 predicted 594
3 SASI_Hs01_00099393 predicted 1627
4 SASI_Hs01_00099394 predicted 1395
5 SASI_Hs02_00344261 predicted 1539
6 SASI_Hs01_00099395 predicted 1487
7 SASI_Hs01_00099397 predicted 1356
8 SASI_Hs01_00099399 predicted 648
9 SASI_Hs01_00099400 predicted 1567
10 SASI_Hs02_00344262 predicted 1586
11 SASI_Hs01_00099396 predicted 1344
12 SASI_Hs01_00099398 predicted 1704
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015967 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099882 predicted 1608
2 SASI_Hs01_00099883 predicted 616
3 SASI_Hs01_00099884 predicted 1640
4 SASI_Hs02_00348633 predicted 1406
5 SASI_Hs01_00099886 predicted 927
6 SASI_Hs01_00099887 predicted 1501
7 SASI_Hs02_00348634 predicted 1142
8 SASI_Hs02_00348635 predicted 1368
9 SASI_Hs01_00099890 predicted 667
10 SASI_Hs01_00099891 predicted 1585
11 SASI_Hs01_00099885 predicted 944
12 SASI_Hs01_00099888 predicted 1368
13 SASI_Hs01_00099889 predicted 1727
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106460 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219178 predicted 1466
2 SASI_Rn02_00219179 predicted 1731
3 SASI_Rn02_00219180 predicted 736
4 SASI_Rn02_00219181 predicted 1245
5 SASI_Rn02_00219182 predicted 1024
6 SASI_Rn02_00219183 predicted 711
7 SASI_Rn02_00219184 predicted 1689
8 SASI_Rn02_00219185 predicted 862
9 SASI_Rn02_00219186 predicted 846
10 SASI_Rn02_00219187 predicted 384
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008979 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138690 predicted 1276
2 SASI_Mm01_00138691 predicted 1740
3 SASI_Mm01_00138692 predicted 385
4 SASI_Mm01_00138693 predicted 1575
5 SASI_Mm01_00138694 predicted 2242
6 SASI_Mm01_00138695 predicted 959
7 SASI_Mm01_00138696 predicted 862
8 SASI_Mm01_00138697 predicted 1802
9 SASI_Mm01_00138698 predicted 218
10 SASI_Mm01_00138699 predicted 1452
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012411
PTPN22 MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase, non-receptor type 22 (lymphoid)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000355586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012411.3-1985s21c1
Sequence:CCGGGTACGGACACCTGAATCATTTCTCGAGAAATGATTCAGGTGTCCGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012411.3-675s21c1
Sequence:CCGGCTCGAACTATCTACCAGTTTCCTCGAGGAAACTGGTAGATAGTTCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012411.3-1643s21c1
Sequence:CCGGTCTAAACACCAAATACGTAATCTCGAGATTACGTATTTGGTGTTTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012411.x-771s1c1
Sequence:CCGGGACTGGTGTTATTTGTGCTATCTCGAGATAGCACAAATAACACCAGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012411.x-983s1c1
Sequence:CCGGCAGAGAGTCAAGCAAAGCATTCTCGAGAATGCTTTGCTTGACTCTCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012411.x-1631s1c1
Sequence:CCGGCTAGTGCTCTTGGTGTATATTCTCGAGAATATACACCAAGAGCACTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012411.x-1429s1c1
Sequence:CCGGGAATTGATACAGCAGAGAGAACTCGAGTTCTCTCTGCTGTATCAATTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012411.x-222s1c1
Sequence:CCGGGAATGCCAAGAATATCAAGAACTCGAGTTCTTGATATTCTTGGCATTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012411
PTPN22 MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase, non-receptor type 22 (lymphoid)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000355586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012411.3-1985s21c1
Sequence:CCGGGTACGGACACCTGAATCATTTCTCGAGAAATGATTCAGGTGTCCGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012411.3-675s21c1
Sequence:CCGGCTCGAACTATCTACCAGTTTCCTCGAGGAAACTGGTAGATAGTTCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012411.3-1643s21c1
Sequence:CCGGTCTAAACACCAAATACGTAATCTCGAGATTACGTATTTGGTGTTTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012411.x-771s1c1
Sequence:CCGGGACTGGTGTTATTTGTGCTATCTCGAGATAGCACAAATAACACCAGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012411.x-983s1c1
Sequence:CCGGCAGAGAGTCAAGCAAAGCATTCTCGAGAATGCTTTGCTTGACTCTCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012411.x-1631s1c1
Sequence:CCGGCTAGTGCTCTTGGTGTATATTCTCGAGAATATACACCAAGAGCACTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012411.x-1429s1c1
Sequence:CCGGGAATTGATACAGCAGAGAGAACTCGAGTTCTCTCTGCTGTATCAATTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012411.x-222s1c1
Sequence:CCGGGAATGCCAAGAATATCAAGAACTCGAGTTCTTGATATTCTTGGCATTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012411
PTPN22 MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase, non-receptor type 22 (lymphoid)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000355586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012411.3-1985s21c1
Sequence:CCGGGTACGGACACCTGAATCATTTCTCGAGAAATGATTCAGGTGTCCGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012411.3-675s21c1
Sequence:CCGGCTCGAACTATCTACCAGTTTCCTCGAGGAAACTGGTAGATAGTTCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012411.3-1643s21c1
Sequence:CCGGTCTAAACACCAAATACGTAATCTCGAGATTACGTATTTGGTGTTTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012411.x-771s1c1
Sequence:CCGGGACTGGTGTTATTTGTGCTATCTCGAGATAGCACAAATAACACCAGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012411.x-983s1c1
Sequence:CCGGCAGAGAGTCAAGCAAAGCATTCTCGAGAATGCTTTGCTTGACTCTCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012411.x-1631s1c1
Sequence:CCGGCTAGTGCTCTTGGTGTATATTCTCGAGAATATACACCAAGAGCACTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012411.x-1429s1c1
Sequence:CCGGGAATTGATACAGCAGAGAGAACTCGAGTTCTCTCTGCTGTATCAATTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012411.x-222s1c1
Sequence:CCGGGAATGCCAAGAATATCAAGAACTCGAGTTCTTGATATTCTTGGCATTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008979
PTPN22 MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase, non-receptor type 22 (lymphoid)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008979.1-1233s1c1
Sequence:CCGGCGGCTAAATCAAGCCCTTCTTCTCGAGAAGAAGGGCTTGATTTAGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008979.1-2292s1c1
Sequence:CCGGCCACATCTTCTAAACAAACATCTCGAGATGTTTGTTTAGAAGATGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008979.1-1457s1c1
Sequence:CCGGCGGACCAAATCAACTCCCTTTCTCGAGAAAGGGAGTTGATTTGGTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008979.1-2247s1c1
Sequence:CCGGCCGTGCAAACTTCTTCTACTACTCGAGTAGTAGAAGAAGTTTGCACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008979.1-345s1c1
Sequence:CCGGCCGATGAGGATTCCAGTTATACTCGAGTATAACTGGAATCCTCATCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008979
PTPN22 MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase, non-receptor type 22 (lymphoid)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008979.1-1233s1c1
Sequence:CCGGCGGCTAAATCAAGCCCTTCTTCTCGAGAAGAAGGGCTTGATTTAGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008979.1-2292s1c1
Sequence:CCGGCCACATCTTCTAAACAAACATCTCGAGATGTTTGTTTAGAAGATGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008979.1-1457s1c1
Sequence:CCGGCGGACCAAATCAACTCCCTTTCTCGAGAAAGGGAGTTGATTTGGTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008979.1-2247s1c1
Sequence:CCGGCCGTGCAAACTTCTTCTACTACTCGAGTAGTAGAAGAAGTTTGCACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008979.1-345s1c1
Sequence:CCGGCCGATGAGGATTCCAGTTATACTCGAGTATAACTGGAATCCTCATCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008979
PTPN22 MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase, non-receptor type 22 (lymphoid)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008979.1-1233s1c1
Sequence:CCGGCGGCTAAATCAAGCCCTTCTTCTCGAGAAGAAGGGCTTGATTTAGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008979.1-2292s1c1
Sequence:CCGGCCACATCTTCTAAACAAACATCTCGAGATGTTTGTTTAGAAGATGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008979.1-1457s1c1
Sequence:CCGGCGGACCAAATCAACTCCCTTTCTCGAGAAAGGGAGTTGATTTGGTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008979.1-2247s1c1
Sequence:CCGGCCGTGCAAACTTCTTCTACTACTCGAGTAGTAGAAGAAGTTTGCACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008979.1-345s1c1
Sequence:CCGGCCGATGAGGATTCCAGTTATACTCGAGTATAACTGGAATCCTCATCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)