EMAIL THIS PAGE TO A FRIEND

PTPN2

protein tyrosine phosphatase, non-receptor type 2

200 Gene Product Result for
Synonyms: PTN2 PTPT TC-PTP TCELLPTP TCPTP
UniProtKB ID: P17706, A8K955, A8MXU3, Q96AU5, Q96HR2
Gene ID:
Human(5771) Summary: The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. Members of the PTP family share a highly conserved catalytic motif, which is essential for the catalytic activity. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. Epidermal growth factor receptor and the adaptor protein Shc were reported to be substrates of this PTP, which suggested the roles in growth factor mediated cell signaling. Multiple alternatively spliced transcript variants encoding different isoforms have been found. Two highly related but distinctly processed pseudogenes that localize to chromosomes 1 and 13, respectively, have been reported. [provided by RefSeq, May 2011]
Mouse(19255) protein tyrosine phosphatase, non-receptor type 2
Rat(117063) protein tyrosine phosphatase, non-receptor type 2
chicken(396409) protein tyrosine phosphatase, non-receptor type 2
domestic cat(101095923) protein tyrosine phosphatase, non-receptor type 2
dog(490563) protein tyrosine phosphatase, non-receptor type 2
cow(540888) protein tyrosine phosphatase, non-receptor type 2
sheep(101106987) protein tyrosine phosphatase, non-receptor type 2
Domestic Rabbit(100338151) protein tyrosine phosphatase, non-receptor type 2
naked mole-rat(101725549) protein tyrosine phosphatase, non-receptor type 2
domestic guinea pig(100732081) protein tyrosine phosphatase, non-receptor type 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002828 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002828 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002828 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008977 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008977 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008977 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU113971 MISSION® esiRNA esiRNA human PTPN2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002828 Rosetta Predictions human pricing
NM_080422 Rosetta Predictions human pricing
NM_080423 Rosetta Predictions human pricing
NM_053990 Rosetta Predictions rat pricing
NM_001127177 Rosetta Predictions mouse pricing
NM_008977 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002828 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00334532 predicted 991
2 SASI_Hs02_00334533 predicted 645
3 SASI_Hs02_00334534 predicted 651
4 SASI_Hs01_00085313 predicted 428
5 SASI_Hs01_00085314 predicted 421
6 SASI_Hs02_00334535 predicted 987
7 SASI_Hs01_00085315 predicted 468
8 SASI_Hs01_00085316 predicted 335
9 SASI_Hs02_00334536 predicted 976
10 SASI_Hs02_00334537 predicted 608
11 SASI_Hs01_00085317 predicted 383
12 SASI_Hs01_00085318 predicted 444
13 SASI_Hs01_00085319 predicted 1312
14 SASI_Hs01_00085320 predicted 1337
15 SASI_Hs01_00085321 predicted 293
16 SASI_Hs01_00085322 predicted 1085
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080422 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00362254 predicted 990
2 SASI_Hs02_00362255 predicted 639
3 SASI_Hs02_00362256 predicted 650
4 SASI_Hs01_00019782 predicted 427
5 SASI_Hs01_00019783 predicted 420
6 SASI_Hs02_00362257 predicted 983
7 SASI_Hs01_00019784 predicted 468
8 SASI_Hs01_00019785 predicted 330
9 SASI_Hs02_00362258 predicted 974
10 SASI_Hs02_00362259 predicted 609
11 SASI_Hs01_00019786 predicted 388
12 SASI_Hs01_00019787 predicted 446
13 SASI_Hs01_00019788 predicted 1309
14 SASI_Hs01_00019789 predicted 291
15 SASI_Hs01_00019790 predicted 1081
16 SASI_Hs01_00019791 predicted 1050
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080423 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00362260 predicted 990
2 SASI_Hs02_00362261 predicted 640
3 SASI_Hs02_00362262 predicted 652
4 SASI_Hs01_00064440 predicted 423
5 SASI_Hs01_00064441 predicted 423
6 SASI_Hs02_00362263 predicted 987
7 SASI_Hs01_00064442 predicted 473
8 SASI_Hs01_00064443 predicted 337
9 SASI_Hs02_00362264 predicted 978
10 SASI_Hs02_00362265 predicted 610
11 SASI_Hs01_00064444 predicted 383
12 SASI_Hs01_00064445 predicted 438
13 SASI_Hs01_00064446 predicted 1244
14 SASI_Hs01_00064447 predicted 1034
15 SASI_Hs01_00064448 predicted 294
16 SASI_Hs01_00064449 predicted 1083
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053990 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033702 predicted 532
2 SASI_Rn01_00033703 predicted 777
3 SASI_Rn01_00033704 predicted 1092
4 SASI_Rn01_00033705 predicted 1044
5 SASI_Rn01_00033706 predicted 1209
6 SASI_Rn01_00033707 predicted 257
7 SASI_Rn01_00033708 predicted 339
8 SASI_Rn02_00266986 predicted 241
9 SASI_Rn01_00033709 predicted 727
10 SASI_Rn01_00033710 predicted 361
11 SASI_Rn01_00033701 predicted 490
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127177 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310117 predicted 572
2 SASI_Mm02_00310118 predicted 868
3 SASI_Mm02_00310119 predicted 827
4 SASI_Mm02_00310120 predicted 434
5 SASI_Mm02_00310121 predicted 430
6 SASI_Mm02_00310122 predicted 255
7 SASI_Mm02_00310123 predicted 836
8 SASI_Mm02_00310124 predicted 540
9 SASI_Mm02_00310125 predicted 329
10 SASI_Mm02_00310126 predicted 952
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008977 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00315061 predicted 568
2 SASI_Mm01_00063553 predicted 860
3 SASI_Mm02_00315062 predicted 826
4 SASI_Mm01_00063556 predicted 440
5 SASI_Mm02_00315063 predicted 433
6 SASI_Mm01_00063559 predicted 252
7 SASI_Mm02_00315064 predicted 840
8 SASI_Mm02_00315065 predicted 535
9 SASI_Mm02_00315066 predicted 331
10 SASI_Mm02_00315067 predicted 948
11 SASI_Mm01_00063554 predicted 1191
12 SASI_Mm01_00063555 predicted 1107
13 SASI_Mm01_00063557 predicted 1147
14 SASI_Mm01_00063558 predicted 1313
15 SASI_Mm01_00063560 predicted 1049
16 SASI_Mm01_00063561 predicted 1089
17 SASI_Mm01_00063562 predicted 576
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002828
VALIDATED
PTPN2 MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase, non-receptor type 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000002784    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002828.x-1542s1c1
Sequence:CCGGGTGCAGTAGAATAGACATCAACTCGAGTTGATGTCTATTCTACTGCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002828.x-712s1c1
Sequence:CCGGCTCACTTTCATTATACTACCTCTCGAGAGGTAGTATAATGAAAGTGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002828.x-1204s1c1
Sequence:CCGGTGCAAGATACAATGGAGGAGACTCGAGTCTCCTCCATTGTATCTTGCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_002828.x-582s1c1
Sequence:CCGGGATGACCAAGAGATGCTGTTTCTCGAGAAACAGCATCTCTTGGTCATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002828.2-992s21c1
Sequence:CCGGATTCTCATACATGGCTATAATCTCGAGATTATAGCCATGTATGAGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314551    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002828.2-1542s21c1
Sequence:CCGGGTGCAGTAGAATAGACATCAACTCGAGTTGATGTCTATTCTACTGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002828.x-636s1c1
Sequence:CCGGGAAGATGTGAAGTCGTATTATCTCGAGATAATACGACTTCACATCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002828.2-354s21c1
Sequence:CCGGTATGATCACAGTCGTGTTAAACTCGAGTTTAACACGACTGTGATCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002828.2-540s21c1
Sequence:CCGGGTGGAGAAAGAATCGGTTAAACTCGAGTTTAACCGATTCTTTCTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_002828.2-635s21c1
Sequence:CCGGAGAAGATGTGAAGTCGTATTACTCGAGTAATACGACTTCACATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002828
VALIDATED
PTPN2 MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase, non-receptor type 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000002784    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002828.x-1542s1c1
Sequence:CCGGGTGCAGTAGAATAGACATCAACTCGAGTTGATGTCTATTCTACTGCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002828.x-712s1c1
Sequence:CCGGCTCACTTTCATTATACTACCTCTCGAGAGGTAGTATAATGAAAGTGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002828.x-1204s1c1
Sequence:CCGGTGCAAGATACAATGGAGGAGACTCGAGTCTCCTCCATTGTATCTTGCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_002828.x-582s1c1
Sequence:CCGGGATGACCAAGAGATGCTGTTTCTCGAGAAACAGCATCTCTTGGTCATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002828.2-992s21c1
Sequence:CCGGATTCTCATACATGGCTATAATCTCGAGATTATAGCCATGTATGAGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314551    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002828.2-1542s21c1
Sequence:CCGGGTGCAGTAGAATAGACATCAACTCGAGTTGATGTCTATTCTACTGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002828.x-636s1c1
Sequence:CCGGGAAGATGTGAAGTCGTATTATCTCGAGATAATACGACTTCACATCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002828.2-354s21c1
Sequence:CCGGTATGATCACAGTCGTGTTAAACTCGAGTTTAACACGACTGTGATCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002828.2-540s21c1
Sequence:CCGGGTGGAGAAAGAATCGGTTAAACTCGAGTTTAACCGATTCTTTCTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_002828.2-635s21c1
Sequence:CCGGAGAAGATGTGAAGTCGTATTACTCGAGTAATACGACTTCACATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002828
VALIDATED
PTPN2 MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase, non-receptor type 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000002784    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002828.x-1542s1c1
Sequence:CCGGGTGCAGTAGAATAGACATCAACTCGAGTTGATGTCTATTCTACTGCACTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002828.x-712s1c1
Sequence:CCGGCTCACTTTCATTATACTACCTCTCGAGAGGTAGTATAATGAAAGTGAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002828.x-1204s1c1
Sequence:CCGGTGCAAGATACAATGGAGGAGACTCGAGTCTCCTCCATTGTATCTTGCATTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_002828.x-582s1c1
Sequence:CCGGGATGACCAAGAGATGCTGTTTCTCGAGAAACAGCATCTCTTGGTCATCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002828.2-992s21c1
Sequence:CCGGATTCTCATACATGGCTATAATCTCGAGATTATAGCCATGTATGAGAATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314551    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002828.2-1542s21c1
Sequence:CCGGGTGCAGTAGAATAGACATCAACTCGAGTTGATGTCTATTCTACTGCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002828.x-636s1c1
Sequence:CCGGGAAGATGTGAAGTCGTATTATCTCGAGATAATACGACTTCACATCTTCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002828.2-354s21c1
Sequence:CCGGTATGATCACAGTCGTGTTAAACTCGAGTTTAACACGACTGTGATCATATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002828.2-540s21c1
Sequence:CCGGGTGGAGAAAGAATCGGTTAAACTCGAGTTTAACCGATTCTTTCTCCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_002828.2-635s21c1
Sequence:CCGGAGAAGATGTGAAGTCGTATTACTCGAGTAATACGACTTCACATCTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008977
VALIDATED
PTPN2 MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase, non-receptor type 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008977.1-758s1c1
Sequence:CCGGCCTGTCTTGTTCTGATGGAAACTCGAGTTTCCATCAGAACAAGACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008977.1-1164s1c1
Sequence:CCGGGCTAAATGAAACTGAACGAAACTCGAGTTTCGTTCAGTTTCATTTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008977.1-1194s1c1
Sequence:CCGGGCCAAGATTGACAGACACCTACTCGAGTAGGTGTCTGTCAATCTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008977.1-928s1c1
Sequence:CCGGCGGTGGAAAGAACTTTCTAAACTCGAGTTTAGAAAGTTCTTTCCACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008977.1-124s1c1
Sequence:CCGGCCGTTATACTTGGAAATTCGACTCGAGTCGAATTTCCAAGTATAACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008977.3-270s21c1
Sequence:CCGGATATGATCACAGTCGTGTTAACTCGAGTTAACACGACTGTGATCATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008977.3-973s21c1
Sequence:CCGGCGGTGGAAAGAACTTTCTAAACTCGAGTTTAGAAAGTTCTTTCCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008977.3-869s21c1
Sequence:CCGGAGTATCGAATGGGACTTATTCCTCGAGGAATAAGTCCCATTCGATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279253    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008977.3-1275s21c1
Sequence:CCGGAGACTATTCTGCAGCTATAAACTCGAGTTTATAGCTGCAGAATAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008977.3-911s21c1
Sequence:CCGGTCTCCTACATGGCCATAATAGCTCGAGCTATTATGGCCATGTAGGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008977
VALIDATED
PTPN2 MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase, non-receptor type 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008977.1-758s1c1
Sequence:CCGGCCTGTCTTGTTCTGATGGAAACTCGAGTTTCCATCAGAACAAGACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008977.1-1164s1c1
Sequence:CCGGGCTAAATGAAACTGAACGAAACTCGAGTTTCGTTCAGTTTCATTTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008977.1-1194s1c1
Sequence:CCGGGCCAAGATTGACAGACACCTACTCGAGTAGGTGTCTGTCAATCTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008977.1-928s1c1
Sequence:CCGGCGGTGGAAAGAACTTTCTAAACTCGAGTTTAGAAAGTTCTTTCCACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008977.1-124s1c1
Sequence:CCGGCCGTTATACTTGGAAATTCGACTCGAGTCGAATTTCCAAGTATAACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008977.3-270s21c1
Sequence:CCGGATATGATCACAGTCGTGTTAACTCGAGTTAACACGACTGTGATCATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008977.3-973s21c1
Sequence:CCGGCGGTGGAAAGAACTTTCTAAACTCGAGTTTAGAAAGTTCTTTCCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008977.3-869s21c1
Sequence:CCGGAGTATCGAATGGGACTTATTCCTCGAGGAATAAGTCCCATTCGATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279253    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008977.3-1275s21c1
Sequence:CCGGAGACTATTCTGCAGCTATAAACTCGAGTTTATAGCTGCAGAATAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008977.3-911s21c1
Sequence:CCGGTCTCCTACATGGCCATAATAGCTCGAGCTATTATGGCCATGTAGGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008977
VALIDATED
PTPN2 MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase, non-receptor type 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008977.1-758s1c1
Sequence:CCGGCCTGTCTTGTTCTGATGGAAACTCGAGTTTCCATCAGAACAAGACAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008977.1-1164s1c1
Sequence:CCGGGCTAAATGAAACTGAACGAAACTCGAGTTTCGTTCAGTTTCATTTAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008977.1-1194s1c1
Sequence:CCGGGCCAAGATTGACAGACACCTACTCGAGTAGGTGTCTGTCAATCTTGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008977.1-928s1c1
Sequence:CCGGCGGTGGAAAGAACTTTCTAAACTCGAGTTTAGAAAGTTCTTTCCACCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008977.1-124s1c1
Sequence:CCGGCCGTTATACTTGGAAATTCGACTCGAGTCGAATTTCCAAGTATAACGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008977.3-270s21c1
Sequence:CCGGATATGATCACAGTCGTGTTAACTCGAGTTAACACGACTGTGATCATATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008977.3-973s21c1
Sequence:CCGGCGGTGGAAAGAACTTTCTAAACTCGAGTTTAGAAAGTTCTTTCCACCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008977.3-869s21c1
Sequence:CCGGAGTATCGAATGGGACTTATTCCTCGAGGAATAAGTCCCATTCGATACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279253    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008977.3-1275s21c1
Sequence:CCGGAGACTATTCTGCAGCTATAAACTCGAGTTTATAGCTGCAGAATAGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008977.3-911s21c1
Sequence:CCGGTCTCCTACATGGCCATAATAGCTCGAGCTATTATGGCCATGTAGGAGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)