EMAIL THIS PAGE TO A FRIEND

PTPN3

protein tyrosine phosphatase, non-receptor type 3

156 Gene Product Result for
Synonyms: PTP-H1 PTPH1
UniProtKB ID: P26045, A0AUW9, E7EN99, E9PGU7
Gene ID:
Human(5774) Summary: The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This protein contains a C-terminal PTP domain and an N-terminal domain homologous to the band 4.1 superfamily of cytoskeletal-associated proteins. P97, a cell cycle regulator involved in a variety of membrane related functions, has been shown to be a substrate of this PTP. This PTP was also found to interact with, and be regulated by adaptor protein 14-3-3 beta. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2009]
Mouse(545622) protein tyrosine phosphatase, non-receptor type 3
Rat(362524) protein tyrosine phosphatase, non-receptor type 3
Zebrafish(407635) protein tyrosine phosphatase, non-receptor type 3
chicken(420963) protein tyrosine phosphatase, non-receptor type 3
dog(610692) protein tyrosine phosphatase, non-receptor type 3
domestic cat(101087881) protein tyrosine phosphatase, non-receptor type 3
Horse(100053951) protein tyrosine phosphatase, non-receptor type 3
cow(511010) protein tyrosine phosphatase, non-receptor type 3
sheep(101114749) protein tyrosine phosphatase, non-receptor type 3
naked mole-rat(101719486) protein tyrosine phosphatase, non-receptor type 3
domestic guinea pig(100728863) protein tyrosine phosphatase, non-receptor type 3
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002829 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002829 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002829 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011207 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011207 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011207 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002829 Rosetta Predictions human pricing
XM_001055737 Rosetta Predictions rat pricing
XM_001055793 Rosetta Predictions rat pricing
XM_001059701 Rosetta Predictions rat pricing
XM_001059757 Rosetta Predictions rat pricing
NM_011207 Rosetta Predictions mouse pricing
XM_485383 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002829 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200967 predicted 1993
2 SASI_Hs01_00200968 predicted 1091
3 SASI_Hs01_00200969 predicted 927
4 SASI_Hs01_00200970 predicted 2230
5 SASI_Hs01_00200972 predicted 919
6 SASI_Hs02_00334538 predicted 1230
7 SASI_Hs01_00200973 predicted 466
8 SASI_Hs01_00200974 predicted 427
9 SASI_Hs02_00334539 predicted 1045
10 SASI_Hs01_00200975 predicted 502
11 SASI_Hs01_00200971 predicted 2742
12 SASI_Hs01_00200976 predicted 996
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055737 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00280800 predicted 1232
2 SASI_Rn02_00280801 predicted 1353
3 SASI_Rn02_00280802 predicted 2200
4 SASI_Rn02_00280803 predicted 620
5 SASI_Rn02_00280804 predicted 2767
6 SASI_Rn02_00280805 predicted 995
7 SASI_Rn02_00280806 predicted 660
8 SASI_Rn02_00280807 predicted 569
9 SASI_Rn02_00280808 predicted 2718
10 SASI_Rn02_00280809 predicted 2056
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055793 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00281015 predicted 322
2 SASI_Rn02_00281016 predicted 1409
3 SASI_Rn02_00281017 predicted 1523
4 SASI_Rn02_00281018 predicted 2373
5 SASI_Rn02_00281019 predicted 792
6 SASI_Rn02_00281020 predicted 1165
7 SASI_Rn02_00281021 predicted 829
8 SASI_Rn02_00281022 predicted 735
9 SASI_Rn02_00281023 predicted 2230
10 SASI_Rn02_00281024 predicted 243
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059701 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00294018 predicted 1238
2 SASI_Rn02_00294019 predicted 1355
3 SASI_Rn02_00294020 predicted 2200
4 SASI_Rn02_00294021 predicted 618
5 SASI_Rn02_00294022 predicted 2762
6 SASI_Rn02_00294023 predicted 993
7 SASI_Rn02_00294024 predicted 659
8 SASI_Rn02_00294025 predicted 565
9 SASI_Rn02_00294026 predicted 2717
10 SASI_Rn02_00294027 predicted 2065
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059757 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00294240 predicted 324
2 SASI_Rn02_00294241 predicted 1411
3 SASI_Rn02_00294242 predicted 1523
4 SASI_Rn02_00294243 predicted 2367
5 SASI_Rn02_00294244 predicted 790
6 SASI_Rn02_00294245 predicted 2935
7 SASI_Rn02_00294246 predicted 833
8 SASI_Rn02_00294247 predicted 733
9 SASI_Rn02_00294248 predicted 2232
10 SASI_Rn02_00294249 predicted 251
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011207 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00320141 predicted 596
2 SASI_Mm02_00320142 predicted 679
3 SASI_Mm02_00320143 predicted 550
4 SASI_Mm02_00320144 predicted 415
5 SASI_Mm02_00320145 predicted 582
6 SASI_Mm02_00320146 predicted 839
7 SASI_Mm02_00320147 predicted 778
8 SASI_Mm02_00320148 predicted 686
9 SASI_Mm02_00320149 predicted 529
10 SASI_Mm02_00320150 predicted 475
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_485383 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00227013 predicted 2248
2 SASI_Mm01_00227014 predicted 2211
3 SASI_Mm01_00227015 predicted 3141
4 SASI_Mm01_00227016 predicted 1016
5 SASI_Mm01_00227017 predicted 2178
6 SASI_Mm01_00227018 predicted 2707
7 SASI_Mm01_00227019 predicted 1371
8 SASI_Mm01_00227020 predicted 1563
9 SASI_Mm01_00227021 predicted 1431
10 SASI_Mm01_00227022 predicted 626
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002829
VALIDATED
PTPN3 MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase, non-receptor type 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002829.3-2455s21c1
Sequence:GTACCGGCGCCTATGTGTCCCGAGAAATCTCGAGATTTCTCGGGACACATAGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002829.3-2810s21c1
Sequence:CCGGCGTGTGTATGAAGAAGGTTTACTCGAGTAAACCTTCTTCATACACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002829.3-2158s21c1
Sequence:CCGGTGACACCACCCGGGTATTATTCTCGAGAATAATACCCGGGTGGTGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320835    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002829.3-3029s21c1
Sequence:CCGGGTAGATAAGCATGCAATTATGCTCGAGCATAATTGCATGCTTATCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002829.3-1114s21c1
Sequence:CCGGGTCGGTAAATAACCAATATTGCTCGAGCAATATTGGTTATTTACCGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002829.3-1420s21c1
Sequence:CCGGCCAAGAGAGTTTATCCGAGAACTCGAGTTCTCGGATAAACTCTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002829.x-2078s1c1
Sequence:CCGGCCGGGTATTATTGCAGGGAAACTCGAGTTTCCCTGCAATAATACCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002829.x-1331s1c1
Sequence:CCGGCCAAGAGAGTTTATCCGAGAACTCGAGTTCTCGGATAAACTCTCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002789    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002829.x-3995s1c1
Sequence:CCGGCCTTTGTGAATACCGTGTTAACTCGAGTTAACACGGTATTCACAAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002829.x-2721s1c1
Sequence:CCGGCGTGTGTATGAAGAAGGTTTACTCGAGTAAACCTTCTTCATACACACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002829.x-2378s1c1
Sequence:CCGGCCGAGAAATGCTGGTCACAAACTCGAGTTTGTGACCAGCATTTCTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002829
VALIDATED
PTPN3 MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase, non-receptor type 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002829.3-2455s21c1
Sequence:GTACCGGCGCCTATGTGTCCCGAGAAATCTCGAGATTTCTCGGGACACATAGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002829.3-2810s21c1
Sequence:CCGGCGTGTGTATGAAGAAGGTTTACTCGAGTAAACCTTCTTCATACACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002829.3-2158s21c1
Sequence:CCGGTGACACCACCCGGGTATTATTCTCGAGAATAATACCCGGGTGGTGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320835    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002829.3-3029s21c1
Sequence:CCGGGTAGATAAGCATGCAATTATGCTCGAGCATAATTGCATGCTTATCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002829.3-1114s21c1
Sequence:CCGGGTCGGTAAATAACCAATATTGCTCGAGCAATATTGGTTATTTACCGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002829.3-1420s21c1
Sequence:CCGGCCAAGAGAGTTTATCCGAGAACTCGAGTTCTCGGATAAACTCTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002829.x-2078s1c1
Sequence:CCGGCCGGGTATTATTGCAGGGAAACTCGAGTTTCCCTGCAATAATACCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002829.x-1331s1c1
Sequence:CCGGCCAAGAGAGTTTATCCGAGAACTCGAGTTCTCGGATAAACTCTCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002789    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002829.x-3995s1c1
Sequence:CCGGCCTTTGTGAATACCGTGTTAACTCGAGTTAACACGGTATTCACAAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002829.x-2721s1c1
Sequence:CCGGCGTGTGTATGAAGAAGGTTTACTCGAGTAAACCTTCTTCATACACACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002829.x-2378s1c1
Sequence:CCGGCCGAGAAATGCTGGTCACAAACTCGAGTTTGTGACCAGCATTTCTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002829
VALIDATED
PTPN3 MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase, non-receptor type 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002829.3-2455s21c1
Sequence:GTACCGGCGCCTATGTGTCCCGAGAAATCTCGAGATTTCTCGGGACACATAGGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002829.3-2810s21c1
Sequence:CCGGCGTGTGTATGAAGAAGGTTTACTCGAGTAAACCTTCTTCATACACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002829.3-2158s21c1
Sequence:CCGGTGACACCACCCGGGTATTATTCTCGAGAATAATACCCGGGTGGTGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320835    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002829.3-3029s21c1
Sequence:CCGGGTAGATAAGCATGCAATTATGCTCGAGCATAATTGCATGCTTATCTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002829.3-1114s21c1
Sequence:CCGGGTCGGTAAATAACCAATATTGCTCGAGCAATATTGGTTATTTACCGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002829.3-1420s21c1
Sequence:CCGGCCAAGAGAGTTTATCCGAGAACTCGAGTTCTCGGATAAACTCTCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002829.x-2078s1c1
Sequence:CCGGCCGGGTATTATTGCAGGGAAACTCGAGTTTCCCTGCAATAATACCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002829.x-1331s1c1
Sequence:CCGGCCAAGAGAGTTTATCCGAGAACTCGAGTTCTCGGATAAACTCTCTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002789    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002829.x-3995s1c1
Sequence:CCGGCCTTTGTGAATACCGTGTTAACTCGAGTTAACACGGTATTCACAAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002829.x-2721s1c1
Sequence:CCGGCGTGTGTATGAAGAAGGTTTACTCGAGTAAACCTTCTTCATACACACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002829.x-2378s1c1
Sequence:CCGGCCGAGAAATGCTGGTCACAAACTCGAGTTTGTGACCAGCATTTCTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011207
VALIDATED
PTPN3 MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase, non-receptor type 3
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000347504    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011207.2-3418s21c1
Sequence:CCGGGAGGATGAACAGGATCTATTCCTCGAGGAATAGATCCTGTTCATCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011207.2-635s21c1
Sequence:CCGGCGTACGCAGTACAATCTCATTCTCGAGAATGAGATTGTACTGCGTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011207.2-943s21c1
Sequence:CCGGCCTTGGGTGAACATACTCAAACTCGAGTTTGAGTATGTTCACCCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011207.2-704s21c1
Sequence:CCGGGCCAGTTCATACCAGATCAAACTCGAGTTTGATCTGGTATGAACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011207
VALIDATED
PTPN3 MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase, non-receptor type 3
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000347504    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011207.2-3418s21c1
Sequence:CCGGGAGGATGAACAGGATCTATTCCTCGAGGAATAGATCCTGTTCATCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011207.2-635s21c1
Sequence:CCGGCGTACGCAGTACAATCTCATTCTCGAGAATGAGATTGTACTGCGTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011207.2-943s21c1
Sequence:CCGGCCTTGGGTGAACATACTCAAACTCGAGTTTGAGTATGTTCACCCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011207.2-704s21c1
Sequence:CCGGGCCAGTTCATACCAGATCAAACTCGAGTTTGATCTGGTATGAACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011207
VALIDATED
PTPN3 MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase, non-receptor type 3
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000347504    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011207.2-3418s21c1
Sequence:CCGGGAGGATGAACAGGATCTATTCCTCGAGGAATAGATCCTGTTCATCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011207.2-635s21c1
Sequence:CCGGCGTACGCAGTACAATCTCATTCTCGAGAATGAGATTGTACTGCGTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011207.2-943s21c1
Sequence:CCGGCCTTGGGTGAACATACTCAAACTCGAGTTTGAGTATGTTCACCCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011207.2-704s21c1
Sequence:CCGGGCCAGTTCATACCAGATCAAACTCGAGTTTGATCTGGTATGAACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)