EMAIL THIS PAGE TO A FRIEND

PTPN4

protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte)

128 Gene Product Result for
Synonyms: MEG PTPMEG PTPMEG1
UniProtKB ID: P29074, B2RBV8, Q9UDA7
Gene ID:
Human(5775) Summary: The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This protein contains a C-terminal PTP domain and an N-terminal domain homologous to the band 4.1 superfamily of cytoskeletal-associated proteins. This PTP has been shown to interact with glutamate receptor delta 2 and epsilon subunits, and is thought to play a role in signalling downstream of the glutamate receptors through tyrosine dephosphorylation. [provided by RefSeq, Jul 2008]
Mouse(19258) protein tyrosine phosphatase, non-receptor type 4
Rat(246116) protein tyrosine phosphatase, non-receptor type 4
domestic guinea pig(100714533) protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte)
naked mole-rat(101701882) protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte)
Domestic Rabbit(100352155) protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte)
cow(512883) protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte)
sheep(101112629) protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte)
chicken(424234) protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte)
dog(483882) protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte)
Horse(100060583) protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte)
domestic cat(101081915) protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002830 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002830 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002830 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019933 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019933 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019933 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002830 Rosetta Predictions human pricing
XM_001053943 Rosetta Predictions rat pricing
XM_341109 Rosetta Predictions rat pricing
NM_019933 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002830 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00334540 predicted 2816
2 SASI_Hs01_00082704 predicted 1919
3 SASI_Hs01_00082705 predicted 885
4 SASI_Hs01_00082707 predicted 2465
5 SASI_Hs01_00082708 predicted 3031
6 SASI_Hs01_00082710 predicted 1428
7 SASI_Hs01_00082711 predicted 3392
8 SASI_Hs01_00082712 predicted 2569
9 SASI_Hs02_00334541 predicted 857
10 SASI_Hs02_00334542 predicted 2012
11 SASI_Hs01_00082703 predicted 2895
12 SASI_Hs01_00082706 predicted 2286
13 SASI_Hs01_00082709 predicted 1042
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053943 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00274120 predicted 1305
2 SASI_Rn02_00274121 predicted 2327
3 SASI_Rn02_00274122 predicted 1041
4 SASI_Rn02_00274123 predicted 690
5 SASI_Rn02_00274124 predicted 527
6 SASI_Rn02_00274125 predicted 1635
7 SASI_Rn02_00274126 predicted 1969
8 SASI_Rn02_00274127 predicted 2363
9 SASI_Rn02_00274128 predicted 1691
10 SASI_Rn02_00274129 predicted 248
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341109 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392371 predicted 1311
2 SASI_Rn02_00392372 predicted 2326
3 SASI_Rn02_00392373 predicted 2808
4 SASI_Rn02_00392374 predicted 1043
5 SASI_Rn02_00392375 predicted 688
6 SASI_Rn02_00392376 predicted 2444
7 SASI_Rn02_00392377 predicted 1636
8 SASI_Rn02_00392378 predicted 1993
9 SASI_Rn02_00392379 predicted 841
10 SASI_Rn02_00392380 predicted 1968
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019933 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043859 predicted 2491
2 SASI_Mm02_00325218 predicted 3014
3 SASI_Mm01_00043860 predicted 1915
4 SASI_Mm01_00043861 predicted 1986
5 SASI_Mm02_00325219 predicted 2065
6 SASI_Mm01_00043863 predicted 2445
7 SASI_Mm01_00043865 predicted 534
8 SASI_Mm02_00325220 predicted 2844
9 SASI_Mm01_00043866 predicted 845
10 SASI_Mm01_00043867 predicted 2804
11 SASI_Mm01_00043858 predicted 1062
12 SASI_Mm01_00043862 predicted 2169
13 SASI_Mm01_00043864 predicted 1722
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002830
VALIDATED
PTPN4 MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000002790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002830.x-3240s1c1
Sequence:CCGGCCCTGATGATTCGAGTGACTTCTCGAGAAGTCACTCGAATCATCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002830.x-1195s1c1
Sequence:CCGGCCTTCTAATACTGCTGCCCTTCTCGAGAAGGGCAGCAGTATTAGAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002830.x-2584s1c1
Sequence:CCGGGCTGTATATGATGTAGTGGAACTCGAGTTCCACTACATCATATACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002830.x-2084s1c1
Sequence:CCGGCGTCATCAACACAAGCTAATACTCGAGTATTAGCTTGTGTTGATGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002791    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002830.x-3766s1c1
Sequence:CCGGGCTCCGAACAAATAGTAAATACTCGAGTATTTACTATTTGTTCGGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382110    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002830.2-3620s21c1
Sequence:GTACCGGTGCTCGCAGGAAATGGCATTTCTCGAGAAATGCCATTTCCTGCGAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002830.2-2584s21c1
Sequence:CCGGGCTGTATATGATGTAGTGGAACTCGAGTTCCACTACATCATATACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338350    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002830.2-3789s21c1
Sequence:CCGGTGAGTATGTTCAGGGTAATTTCTCGAGAAATTACCCTGAACATACTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002830.2-2620s21c1
Sequence:CCGGGAGCCAGATTTCCAGTATATTCTCGAGAATATACTGGAAATCTGGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002830.2-2084s21c1
Sequence:CCGGCGTCATCAACACAAGCTAATACTCGAGTATTAGCTTGTGTTGATGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002830.2-2843s21c1
Sequence:CCGGATGATGCCACACGGGTCATTTCTCGAGAAATGACCCGTGTGGCATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002830.2-3453s21c1
Sequence:GTACCGGGATCCAAACACCTAGTCAATACTCGAGTATTGACTAGGTGTTTGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002830
VALIDATED
PTPN4 MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000002790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002830.x-3240s1c1
Sequence:CCGGCCCTGATGATTCGAGTGACTTCTCGAGAAGTCACTCGAATCATCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002830.x-1195s1c1
Sequence:CCGGCCTTCTAATACTGCTGCCCTTCTCGAGAAGGGCAGCAGTATTAGAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002830.x-2584s1c1
Sequence:CCGGGCTGTATATGATGTAGTGGAACTCGAGTTCCACTACATCATATACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002830.x-2084s1c1
Sequence:CCGGCGTCATCAACACAAGCTAATACTCGAGTATTAGCTTGTGTTGATGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002791    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002830.x-3766s1c1
Sequence:CCGGGCTCCGAACAAATAGTAAATACTCGAGTATTTACTATTTGTTCGGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382110    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002830.2-3620s21c1
Sequence:GTACCGGTGCTCGCAGGAAATGGCATTTCTCGAGAAATGCCATTTCCTGCGAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002830.2-2584s21c1
Sequence:CCGGGCTGTATATGATGTAGTGGAACTCGAGTTCCACTACATCATATACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338350    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002830.2-3789s21c1
Sequence:CCGGTGAGTATGTTCAGGGTAATTTCTCGAGAAATTACCCTGAACATACTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002830.2-2620s21c1
Sequence:CCGGGAGCCAGATTTCCAGTATATTCTCGAGAATATACTGGAAATCTGGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002830.2-2084s21c1
Sequence:CCGGCGTCATCAACACAAGCTAATACTCGAGTATTAGCTTGTGTTGATGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002830.2-2843s21c1
Sequence:CCGGATGATGCCACACGGGTCATTTCTCGAGAAATGACCCGTGTGGCATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002830.2-3453s21c1
Sequence:GTACCGGGATCCAAACACCTAGTCAATACTCGAGTATTGACTAGGTGTTTGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002830
VALIDATED
PTPN4 MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000002790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002830.x-3240s1c1
Sequence:CCGGCCCTGATGATTCGAGTGACTTCTCGAGAAGTCACTCGAATCATCAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002830.x-1195s1c1
Sequence:CCGGCCTTCTAATACTGCTGCCCTTCTCGAGAAGGGCAGCAGTATTAGAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002830.x-2584s1c1
Sequence:CCGGGCTGTATATGATGTAGTGGAACTCGAGTTCCACTACATCATATACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002830.x-2084s1c1
Sequence:CCGGCGTCATCAACACAAGCTAATACTCGAGTATTAGCTTGTGTTGATGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002791    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002830.x-3766s1c1
Sequence:CCGGGCTCCGAACAAATAGTAAATACTCGAGTATTTACTATTTGTTCGGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382110    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002830.2-3620s21c1
Sequence:GTACCGGTGCTCGCAGGAAATGGCATTTCTCGAGAAATGCCATTTCCTGCGAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002830.2-2584s21c1
Sequence:CCGGGCTGTATATGATGTAGTGGAACTCGAGTTCCACTACATCATATACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338350    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002830.2-3789s21c1
Sequence:CCGGTGAGTATGTTCAGGGTAATTTCTCGAGAAATTACCCTGAACATACTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002830.2-2620s21c1
Sequence:CCGGGAGCCAGATTTCCAGTATATTCTCGAGAATATACTGGAAATCTGGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002830.2-2084s21c1
Sequence:CCGGCGTCATCAACACAAGCTAATACTCGAGTATTAGCTTGTGTTGATGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002830.2-2843s21c1
Sequence:CCGGATGATGCCACACGGGTCATTTCTCGAGAAATGACCCGTGTGGCATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002830.2-3453s21c1
Sequence:GTACCGGGATCCAAACACCTAGTCAATACTCGAGTATTGACTAGGTGTTTGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019933
VALIDATED
PTPN4 MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019933.1-1546s1c1
Sequence:CCGGCCACATGATAACCTTGTTCTACTCGAGTAGAACAAGGTTATCATGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019933.1-525s1c1
Sequence:CCGGCCTCTCAGATTATTCTTTCATCTCGAGATGAAAGAATAATCTGAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019933.1-1411s1c1
Sequence:CCGGCCACCCAAACAATCTAAGAAACTCGAGTTTCTTAGATTGTTTGGGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019933.1-1060s1c1
Sequence:CCGGGCAAATAAAGACAGGGTATTTCTCGAGAAATACCCTGTCTTTATTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019933.1-2643s1c1
Sequence:CCGGGCCAGTTTATCCACTAGACATCTCGAGATGTCTAGTGGATAAACTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276888    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019933.2-3010s21c1
Sequence:CCGGATGTTCACTGTGCCATAATACCTCGAGGTATTATGGCACAGTGAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019933.2-1718s21c1
Sequence:CCGGCCACATGATAACCTTGTTCTACTCGAGTAGAACAAGGTTATCATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019933.2-1423s21c1
Sequence:CCGGGCCGTCTTCAGTTGGTCATTTCTCGAGAAATGACCAACTGAAGACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019933.2-1875s21c1
Sequence:CCGGGGGACCAAGTGGTACTAATAACTCGAGTTATTAGTACCACTTGGTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019933.2-2036s21c1
Sequence:CCGGGAACCAGACTTCCAGTATATTCTCGAGAATATACTGGAAGTCTGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019933
VALIDATED
PTPN4 MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019933.1-1546s1c1
Sequence:CCGGCCACATGATAACCTTGTTCTACTCGAGTAGAACAAGGTTATCATGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019933.1-525s1c1
Sequence:CCGGCCTCTCAGATTATTCTTTCATCTCGAGATGAAAGAATAATCTGAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019933.1-1411s1c1
Sequence:CCGGCCACCCAAACAATCTAAGAAACTCGAGTTTCTTAGATTGTTTGGGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019933.1-1060s1c1
Sequence:CCGGGCAAATAAAGACAGGGTATTTCTCGAGAAATACCCTGTCTTTATTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019933.1-2643s1c1
Sequence:CCGGGCCAGTTTATCCACTAGACATCTCGAGATGTCTAGTGGATAAACTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276888    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019933.2-3010s21c1
Sequence:CCGGATGTTCACTGTGCCATAATACCTCGAGGTATTATGGCACAGTGAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019933.2-1718s21c1
Sequence:CCGGCCACATGATAACCTTGTTCTACTCGAGTAGAACAAGGTTATCATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019933.2-1423s21c1
Sequence:CCGGGCCGTCTTCAGTTGGTCATTTCTCGAGAAATGACCAACTGAAGACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019933.2-1875s21c1
Sequence:CCGGGGGACCAAGTGGTACTAATAACTCGAGTTATTAGTACCACTTGGTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019933.2-2036s21c1
Sequence:CCGGGAACCAGACTTCCAGTATATTCTCGAGAATATACTGGAAGTCTGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019933
VALIDATED
PTPN4 MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019933.1-1546s1c1
Sequence:CCGGCCACATGATAACCTTGTTCTACTCGAGTAGAACAAGGTTATCATGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019933.1-525s1c1
Sequence:CCGGCCTCTCAGATTATTCTTTCATCTCGAGATGAAAGAATAATCTGAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019933.1-1411s1c1
Sequence:CCGGCCACCCAAACAATCTAAGAAACTCGAGTTTCTTAGATTGTTTGGGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019933.1-1060s1c1
Sequence:CCGGGCAAATAAAGACAGGGTATTTCTCGAGAAATACCCTGTCTTTATTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019933.1-2643s1c1
Sequence:CCGGGCCAGTTTATCCACTAGACATCTCGAGATGTCTAGTGGATAAACTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276888    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019933.2-3010s21c1
Sequence:CCGGATGTTCACTGTGCCATAATACCTCGAGGTATTATGGCACAGTGAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019933.2-1718s21c1
Sequence:CCGGCCACATGATAACCTTGTTCTACTCGAGTAGAACAAGGTTATCATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019933.2-1423s21c1
Sequence:CCGGGCCGTCTTCAGTTGGTCATTTCTCGAGAAATGACCAACTGAAGACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019933.2-1875s21c1
Sequence:CCGGGGGACCAAGTGGTACTAATAACTCGAGTTATTAGTACCACTTGGTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019933.2-2036s21c1
Sequence:CCGGGAACCAGACTTCCAGTATATTCTCGAGAATATACTGGAAGTCTGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)