EMAIL THIS PAGE TO A FRIEND

PTPN9

protein tyrosine phosphatase, non-receptor type 9

181 Gene Product Result for
Synonyms: MEG2 PTPMEG2
UniProtKB ID: P43378, Q53XR9
Gene ID:
Human(5780) Summary: The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an N-terminal domain that shares a significant similarity with yeast SEC14, which is a protein that has phosphatidylinositol transfer activity and is required for protein secretion through the Golgi complex in yeast. This PTP was found to be activated by polyphosphoinositide, and is thought to be involved in signaling events regulating phagocytosis. [provided by RefSeq, Jul 2008]
Mouse(56294) protein tyrosine phosphatase, non-receptor type 9
Rat(266611) protein tyrosine phosphatase, non-receptor type 9
domestic guinea pig(100735156) protein tyrosine phosphatase, non-receptor type 9
naked mole-rat(101718345) protein tyrosine phosphatase, non-receptor type 9
cow(505220) protein tyrosine phosphatase, non-receptor type 9
sheep(101105855) protein tyrosine phosphatase, non-receptor type 9
chicken(415308) protein tyrosine phosphatase, non-receptor type 9
domestic cat(101101222) protein tyrosine phosphatase, non-receptor type 9
dog(612991) protein tyrosine phosphatase, non-receptor type 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002833 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002833 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002833 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019651 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019651 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019651 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002833 siRNAs that have been validated in the lab human pricing
NM_001013040 Rosetta Predictions rat pricing
NM_019651 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002833 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129077 validated 2346
2 SASI_Hs01_00129076 predicted 1323
3 SASI_Hs01_00129078 predicted 1100
4 SASI_Hs01_00129079 predicted 1581
5 SASI_Hs01_00129080 predicted 1527
6 SASI_Hs01_00129081 predicted 2275
7 SASI_Hs01_00129082 predicted 1038
8 SASI_Hs01_00129083 predicted 1631
9 SASI_Hs01_00129084 predicted 2293
10 SASI_Hs01_00129085 predicted 568
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013040 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00069903 predicted 833
2 SASI_Rn01_00069904 predicted 609
3 SASI_Rn01_00069905 predicted 472
4 SASI_Rn01_00069907 predicted 294
5 SASI_Rn01_00069908 predicted 1715
6 SASI_Rn01_00069909 predicted 922
7 SASI_Rn01_00069910 predicted 550
8 SASI_Rn01_00069911 predicted 580
9 SASI_Rn01_00069912 predicted 980
10 SASI_Rn02_00200633 predicted 1332
11 SASI_Rn01_00069906 predicted 1729
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019651 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172829 predicted 1441
2 SASI_Mm01_00172830 predicted 2462
3 SASI_Mm01_00172831 predicted 1523
4 SASI_Mm01_00172832 predicted 1122
5 SASI_Mm01_00172833 predicted 683
6 SASI_Mm01_00172834 predicted 1777
7 SASI_Mm01_00172835 predicted 1726
8 SASI_Mm01_00172837 predicted 1218
9 SASI_Mm01_00172838 predicted 1178
10 SASI_Mm02_00324691 predicted 1149
11 SASI_Mm01_00172836 predicted 1255
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002833
VALIDATED
PTPN9 MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase, non-receptor type 9
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000002825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002833.x-1385s1c1
Sequence:CCGGGACTATGTTAATGCCAGGCAACTCGAGTTGCCTGGCATTAACATAGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002833.x-1808s1c1
Sequence:CCGGCTAGGCGTGGAGAACATGAATCTCGAGATTCATGTTCTCCACGCCTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002833.x-722s1c1
Sequence:CCGGCGAAGGAAGGAAGGCATTGTACTCGAGTACAATGCCTTCCTTCCTTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002828    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002833.x-2517s1c1
Sequence:CCGGGCTATCAAACTGTGCCTTATTCTCGAGAATAAGGCACAGTTTGATAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002833.x-1561s1c1
Sequence:CCGGCCATACTCAGACAGATTACATCTCGAGATGTAATCTGTCTGAGTATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381117    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002833.2-2436s21c1
Sequence:GTACCGGCCTTTCCCTTTGGCTAGATAACTCGAGTTATCTAGCCAAAGGGAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002833.2-603s21c1
Sequence:GTACCGGAGTGGACAGTTCAGTACAATGCTCGAGCATTGTACTGAACTGTCCACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002833
VALIDATED
PTPN9 MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase, non-receptor type 9
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000002825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002833.x-1385s1c1
Sequence:CCGGGACTATGTTAATGCCAGGCAACTCGAGTTGCCTGGCATTAACATAGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002833.x-1808s1c1
Sequence:CCGGCTAGGCGTGGAGAACATGAATCTCGAGATTCATGTTCTCCACGCCTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002833.x-722s1c1
Sequence:CCGGCGAAGGAAGGAAGGCATTGTACTCGAGTACAATGCCTTCCTTCCTTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002828    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002833.x-2517s1c1
Sequence:CCGGGCTATCAAACTGTGCCTTATTCTCGAGAATAAGGCACAGTTTGATAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002833.x-1561s1c1
Sequence:CCGGCCATACTCAGACAGATTACATCTCGAGATGTAATCTGTCTGAGTATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381117    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002833.2-2436s21c1
Sequence:GTACCGGCCTTTCCCTTTGGCTAGATAACTCGAGTTATCTAGCCAAAGGGAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002833.2-603s21c1
Sequence:GTACCGGAGTGGACAGTTCAGTACAATGCTCGAGCATTGTACTGAACTGTCCACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002833
VALIDATED
PTPN9 MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase, non-receptor type 9
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000002825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002833.x-1385s1c1
Sequence:CCGGGACTATGTTAATGCCAGGCAACTCGAGTTGCCTGGCATTAACATAGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002833.x-1808s1c1
Sequence:CCGGCTAGGCGTGGAGAACATGAATCTCGAGATTCATGTTCTCCACGCCTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002833.x-722s1c1
Sequence:CCGGCGAAGGAAGGAAGGCATTGTACTCGAGTACAATGCCTTCCTTCCTTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002828    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002833.x-2517s1c1
Sequence:CCGGGCTATCAAACTGTGCCTTATTCTCGAGAATAAGGCACAGTTTGATAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002833.x-1561s1c1
Sequence:CCGGCCATACTCAGACAGATTACATCTCGAGATGTAATCTGTCTGAGTATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381117    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002833.2-2436s21c1
Sequence:GTACCGGCCTTTCCCTTTGGCTAGATAACTCGAGTTATCTAGCCAAAGGGAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002833.2-603s21c1
Sequence:GTACCGGAGTGGACAGTTCAGTACAATGCTCGAGCATTGTACTGAACTGTCCACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019651
PTPN9 MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase, non-receptor type 9
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019651.1-564s1c1
Sequence:CCGGCGGGTCTAATTATGCCAACTTCTCGAGAAGTTGGCATAATTAGACCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019651.1-1149s1c1
Sequence:CCGGCCACACTCAGACAGATTACATCTCGAGATGTAATCTGTCTGAGTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019651.1-739s1c1
Sequence:CCGGCCCATATTAACGACATCTGAACTCGAGTTCAGATGTCGTTAATATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019651.1-727s1c1
Sequence:CCGGCGGGAAAGGATTCCCATATTACTCGAGTAATATGGGAATCCTTTCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019651.1-1712s1c1
Sequence:CCGGGCACCCTTAATGTGTTCCATACTCGAGTATGGAACACATTAAGGGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019651.2-1083s21c1
Sequence:CCGGTATGACATGTGCGGGTCTAATCTCGAGATTAGACCCGCACATGTCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366554    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019651.2-2850s21c1
Sequence:CCGGCGAGTGCCAAGCACGTTTATACTCGAGTATAAACGTGCTTGGCACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019651.2-1489s21c1
Sequence:CCGGTCCAAGAGTTGGTAGACTATGCTCGAGCATAGTCTACCAACTCTTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375375    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019651.2-2553s21c1
Sequence:CCGGCCTTTCCCTTTGGCTAGATAACTCGAGTTATCTAGCCAAAGGGAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019651.2-1205s21c1
Sequence:CCGGATGGTTCCGAGTGCCCTATTCCTCGAGGAATAGGGCACTCGGAACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019651
PTPN9 MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase, non-receptor type 9
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019651.1-564s1c1
Sequence:CCGGCGGGTCTAATTATGCCAACTTCTCGAGAAGTTGGCATAATTAGACCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019651.1-1149s1c1
Sequence:CCGGCCACACTCAGACAGATTACATCTCGAGATGTAATCTGTCTGAGTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019651.1-739s1c1
Sequence:CCGGCCCATATTAACGACATCTGAACTCGAGTTCAGATGTCGTTAATATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019651.1-727s1c1
Sequence:CCGGCGGGAAAGGATTCCCATATTACTCGAGTAATATGGGAATCCTTTCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019651.1-1712s1c1
Sequence:CCGGGCACCCTTAATGTGTTCCATACTCGAGTATGGAACACATTAAGGGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019651.2-1083s21c1
Sequence:CCGGTATGACATGTGCGGGTCTAATCTCGAGATTAGACCCGCACATGTCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366554    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019651.2-2850s21c1
Sequence:CCGGCGAGTGCCAAGCACGTTTATACTCGAGTATAAACGTGCTTGGCACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019651.2-1489s21c1
Sequence:CCGGTCCAAGAGTTGGTAGACTATGCTCGAGCATAGTCTACCAACTCTTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375375    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019651.2-2553s21c1
Sequence:CCGGCCTTTCCCTTTGGCTAGATAACTCGAGTTATCTAGCCAAAGGGAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019651.2-1205s21c1
Sequence:CCGGATGGTTCCGAGTGCCCTATTCCTCGAGGAATAGGGCACTCGGAACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019651
PTPN9 MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase, non-receptor type 9
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019651.1-564s1c1
Sequence:CCGGCGGGTCTAATTATGCCAACTTCTCGAGAAGTTGGCATAATTAGACCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019651.1-1149s1c1
Sequence:CCGGCCACACTCAGACAGATTACATCTCGAGATGTAATCTGTCTGAGTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019651.1-739s1c1
Sequence:CCGGCCCATATTAACGACATCTGAACTCGAGTTCAGATGTCGTTAATATGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019651.1-727s1c1
Sequence:CCGGCGGGAAAGGATTCCCATATTACTCGAGTAATATGGGAATCCTTTCCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019651.1-1712s1c1
Sequence:CCGGGCACCCTTAATGTGTTCCATACTCGAGTATGGAACACATTAAGGGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019651.2-1083s21c1
Sequence:CCGGTATGACATGTGCGGGTCTAATCTCGAGATTAGACCCGCACATGTCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366554    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019651.2-2850s21c1
Sequence:CCGGCGAGTGCCAAGCACGTTTATACTCGAGTATAAACGTGCTTGGCACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019651.2-1489s21c1
Sequence:CCGGTCCAAGAGTTGGTAGACTATGCTCGAGCATAGTCTACCAACTCTTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375375    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019651.2-2553s21c1
Sequence:CCGGCCTTTCCCTTTGGCTAGATAACTCGAGTTATCTAGCCAAAGGGAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019651.2-1205s21c1
Sequence:CCGGATGGTTCCGAGTGCCCTATTCCTCGAGGAATAGGGCACTCGGAACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)