EMAIL THIS PAGE TO A FRIEND

PTPRA

protein tyrosine phosphatase, receptor type, A

114 Gene Product Result for
Synonyms: HEPTP HLPR HPTPA HPTPalpha LRP PTPA PTPRL2 R-PTP-alpha RPTPA
UniProtKB ID: P18433, A8K2G8, D3DVX5, Q14513, Q7Z2I2, Q96TD9
Gene ID:
Human(5786) Summary: The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. This PTP has been shown to dephosphorylate and activate Src family tyrosine kinases, and is implicated in the regulation of integrin signaling, cell adhesion and proliferation. Three alternatively spliced variants of this gene, which encode two distinct isoforms, have been reported. [provided by RefSeq, Jul 2008]
Mouse(19262) protein tyrosine phosphatase, receptor type, A
Rat(25167) protein tyrosine phosphatase, receptor type, A
Zebrafish(140818) protein tyrosine phosphatase, receptor type, A
Horse(100066880) protein tyrosine phosphatase, receptor type, A
domestic cat(101096558) protein tyrosine phosphatase, receptor type, A
dog(477176) protein tyrosine phosphatase, receptor type, A
chicken(396060) protein tyrosine phosphatase, receptor type, A
cow(100138017) protein tyrosine phosphatase, receptor type, A
sheep(101101909) protein tyrosine phosphatase, receptor type, A
naked mole-rat(101716097) protein tyrosine phosphatase, receptor type, A
Domestic Rabbit(100342875) protein tyrosine phosphatase, receptor type, A
domestic guinea pig(100720460) protein tyrosine phosphatase, receptor type, A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
510602 6-Phenyl-3(2H)-pyridazinone 98% human pricing
M4659 Milrinone ≥97% (TLC), powder human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002836 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002836 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002836 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008980 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008980 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008980 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002836 Rosetta Predictions human pricing
NM_080840 Rosetta Predictions human pricing
NM_080841 Rosetta Predictions human pricing
NM_012763 Rosetta Predictions rat pricing
NM_008980 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002836 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200627 predicted 2555
2 SASI_Hs01_00200628 predicted 2530
3 SASI_Hs01_00200629 predicted 2264
4 SASI_Hs02_00334559 predicted 1758
5 SASI_Hs01_00200630 predicted 2131
6 SASI_Hs01_00200631 predicted 2259
7 SASI_Hs01_00200632 predicted 2019
8 SASI_Hs01_00200633 predicted 2628
9 SASI_Hs01_00200634 predicted 1493
10 SASI_Hs01_00200635 predicted 2635
11 SASI_Hs01_00200636 predicted 2324
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080840 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169093 predicted 2244
2 SASI_Hs01_00169094 predicted 2216
3 SASI_Hs01_00169095 predicted 1959
4 SASI_Hs02_00362631 predicted 1444
5 SASI_Hs01_00169096 predicted 1826
6 SASI_Hs01_00169097 predicted 1945
7 SASI_Hs01_00169098 predicted 1711
8 SASI_Hs01_00169099 predicted 2320
9 SASI_Hs01_00169100 predicted 1186
10 SASI_Hs01_00169101 predicted 2333
11 SASI_Hs01_00169102 predicted 1966
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080841 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244444 predicted 2067
2 SASI_Hs01_00244445 predicted 2038
3 SASI_Hs01_00244446 predicted 1775
4 SASI_Hs02_00362632 predicted 1277
5 SASI_Hs01_00244447 predicted 1647
6 SASI_Hs01_00244448 predicted 1770
7 SASI_Hs01_00244449 predicted 1538
8 SASI_Hs01_00244450 predicted 2143
9 SASI_Hs01_00244451 predicted 1011
10 SASI_Hs01_00244452 predicted 2153
11 SASI_Hs01_00244453 predicted 1835
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012763 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00107161 predicted 486
2 SASI_Rn02_00260132 predicted 351
3 SASI_Rn01_00107164 predicted 1065
4 SASI_Rn02_00260133 predicted 288
5 SASI_Rn01_00107165 predicted 2127
6 SASI_Rn01_00107166 predicted 1440
7 SASI_Rn01_00107167 predicted 586
8 SASI_Rn01_00107169 predicted 1131
9 SASI_Rn02_00260134 predicted 317
10 SASI_Rn02_00260135 predicted 757
11 SASI_Rn01_00107162 predicted 2322
12 SASI_Rn01_00107163 predicted 1652
13 SASI_Rn01_00107168 predicted 1959
14 SASI_Rn01_00107170 predicted 2311
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008980 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00315070 predicted 2489
2 SASI_Mm01_00136492 predicted 1155
3 SASI_Mm01_00136493 predicted 1684
4 SASI_Mm01_00136494 predicted 243
5 SASI_Mm01_00136495 predicted 336
6 SASI_Mm01_00136496 predicted 2147
7 SASI_Mm01_00136497 predicted 490
8 SASI_Mm01_00136498 predicted 529
9 SASI_Mm01_00136499 predicted 1096
10 SASI_Mm01_00136500 predicted 503
11 SASI_Mm01_00136501 predicted 1571
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002836
VALIDATED
PTPRA MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase, receptor type, A
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000367471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002836.3-954s21c1
Sequence:CCGGCACCAATTCTATAGGCATTACCTCGAGGTAATGCCTATAGAATTGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002836.3-787s21c1
Sequence:CCGGTCAACGGCAGAACCAGTTAAACTCGAGTTTAACTGGTTCTGCCGTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002836.3-2466s21c1
Sequence:CCGGCCGGCAGAAGGACTCCTATATCTCGAGATATAGGAGTCCTTCTGCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002836.3-1871s21c1
Sequence:CCGGTCATCACTCAGTTCCACTTTACTCGAGTAAAGTGGAACTGAGTGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002836.3-1371s21c1
Sequence:CCGGGAGAATGGCAGACGACAATAACTCGAGTTATTGTCGTCTGCCATTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338334    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002836.3-3201s21c1
Sequence:CCGGTAGGCTTCTATTACCTATTAGCTCGAGCTAATAGGTAATAGAAGCCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002836.3-1158s21c1
Sequence:CCGGTCTGCTAGTGATCGTGTTTATCTCGAGATAAACACGATCACTAGCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367427    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002836.3-3302s21c1
Sequence:CCGGTTGGATTGATATCGTGAAATCCTCGAGGATTTCACGATATCAATCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002836.x-1319s1c1
Sequence:CCGGCCCAAGCACCAACAGGAAATACTCGAGTATTTCCTGTTGGTGCTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002836.x-2355s1c1
Sequence:CCGGGCCAACATGAAGAAGAACCGTCTCGAGACGGTTCTTCTTCATGTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002836.x-835s1c1
Sequence:CCGGCAAATCCAACTTCTTCACTAACTCGAGTTAGTGAAGAAGTTGGATTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002836.x-905s1c1
Sequence:CCGGCACCTATTTAACCACTGTCAACTCGAGTTGACAGTGGTTAAATAGGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002836    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002836.x-3304s1c1
Sequence:CCGGGTGTGATGTTTGGATTGATATCTCGAGATATCAATCCAAACATCACACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002836
VALIDATED
PTPRA MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase, receptor type, A
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000367471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002836.3-954s21c1
Sequence:CCGGCACCAATTCTATAGGCATTACCTCGAGGTAATGCCTATAGAATTGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002836.3-787s21c1
Sequence:CCGGTCAACGGCAGAACCAGTTAAACTCGAGTTTAACTGGTTCTGCCGTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002836.3-2466s21c1
Sequence:CCGGCCGGCAGAAGGACTCCTATATCTCGAGATATAGGAGTCCTTCTGCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002836.3-1871s21c1
Sequence:CCGGTCATCACTCAGTTCCACTTTACTCGAGTAAAGTGGAACTGAGTGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002836.3-1371s21c1
Sequence:CCGGGAGAATGGCAGACGACAATAACTCGAGTTATTGTCGTCTGCCATTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338334    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002836.3-3201s21c1
Sequence:CCGGTAGGCTTCTATTACCTATTAGCTCGAGCTAATAGGTAATAGAAGCCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002836.3-1158s21c1
Sequence:CCGGTCTGCTAGTGATCGTGTTTATCTCGAGATAAACACGATCACTAGCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367427    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002836.3-3302s21c1
Sequence:CCGGTTGGATTGATATCGTGAAATCCTCGAGGATTTCACGATATCAATCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002836.x-1319s1c1
Sequence:CCGGCCCAAGCACCAACAGGAAATACTCGAGTATTTCCTGTTGGTGCTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002836.x-2355s1c1
Sequence:CCGGGCCAACATGAAGAAGAACCGTCTCGAGACGGTTCTTCTTCATGTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002836.x-835s1c1
Sequence:CCGGCAAATCCAACTTCTTCACTAACTCGAGTTAGTGAAGAAGTTGGATTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002836.x-905s1c1
Sequence:CCGGCACCTATTTAACCACTGTCAACTCGAGTTGACAGTGGTTAAATAGGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002836    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002836.x-3304s1c1
Sequence:CCGGGTGTGATGTTTGGATTGATATCTCGAGATATCAATCCAAACATCACACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002836
VALIDATED
PTPRA MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase, receptor type, A
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000367471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002836.3-954s21c1
Sequence:CCGGCACCAATTCTATAGGCATTACCTCGAGGTAATGCCTATAGAATTGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002836.3-787s21c1
Sequence:CCGGTCAACGGCAGAACCAGTTAAACTCGAGTTTAACTGGTTCTGCCGTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002836.3-2466s21c1
Sequence:CCGGCCGGCAGAAGGACTCCTATATCTCGAGATATAGGAGTCCTTCTGCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002836.3-1871s21c1
Sequence:CCGGTCATCACTCAGTTCCACTTTACTCGAGTAAAGTGGAACTGAGTGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002836.3-1371s21c1
Sequence:CCGGGAGAATGGCAGACGACAATAACTCGAGTTATTGTCGTCTGCCATTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338334    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002836.3-3201s21c1
Sequence:CCGGTAGGCTTCTATTACCTATTAGCTCGAGCTAATAGGTAATAGAAGCCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002836.3-1158s21c1
Sequence:CCGGTCTGCTAGTGATCGTGTTTATCTCGAGATAAACACGATCACTAGCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367427    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002836.3-3302s21c1
Sequence:CCGGTTGGATTGATATCGTGAAATCCTCGAGGATTTCACGATATCAATCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002836.x-1319s1c1
Sequence:CCGGCCCAAGCACCAACAGGAAATACTCGAGTATTTCCTGTTGGTGCTTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002836.x-2355s1c1
Sequence:CCGGGCCAACATGAAGAAGAACCGTCTCGAGACGGTTCTTCTTCATGTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002836.x-835s1c1
Sequence:CCGGCAAATCCAACTTCTTCACTAACTCGAGTTAGTGAAGAAGTTGGATTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002836.x-905s1c1
Sequence:CCGGCACCTATTTAACCACTGTCAACTCGAGTTGACAGTGGTTAAATAGGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002836    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002836.x-3304s1c1
Sequence:CCGGGTGTGATGTTTGGATTGATATCTCGAGATATCAATCCAAACATCACACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008980
PTPRA MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase, receptor type, A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029919    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008980.1-2719s1c1
Sequence:CCGGGTGTGATATTTGGGTTGATATCTCGAGATATCAACCCAAATATCACACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008980.1-1497s1c1
Sequence:CCGGCGGAACGCAAAGTGGATGTATCTCGAGATACATCCACTTTGCGTTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008980.1-881s1c1
Sequence:CCGGCCATTGTTAGAAAGAAGGTTTCTCGAGAAACCTTCTTTCTAACAATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008980.1-2471s1c1
Sequence:CCGGCAGGAGTACATTGACGCCTTTCTCGAGAAAGGCGTCAATGTACTCCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008980.1-242s1c1
Sequence:CCGGCCCACCTATGTGACTACTGTTCTCGAGAACAGTAGTCACATAGGTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008980
PTPRA MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase, receptor type, A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029919    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008980.1-2719s1c1
Sequence:CCGGGTGTGATATTTGGGTTGATATCTCGAGATATCAACCCAAATATCACACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008980.1-1497s1c1
Sequence:CCGGCGGAACGCAAAGTGGATGTATCTCGAGATACATCCACTTTGCGTTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008980.1-881s1c1
Sequence:CCGGCCATTGTTAGAAAGAAGGTTTCTCGAGAAACCTTCTTTCTAACAATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008980.1-2471s1c1
Sequence:CCGGCAGGAGTACATTGACGCCTTTCTCGAGAAAGGCGTCAATGTACTCCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008980.1-242s1c1
Sequence:CCGGCCCACCTATGTGACTACTGTTCTCGAGAACAGTAGTCACATAGGTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008980
PTPRA MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase, receptor type, A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029919    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008980.1-2719s1c1
Sequence:CCGGGTGTGATATTTGGGTTGATATCTCGAGATATCAACCCAAATATCACACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008980.1-1497s1c1
Sequence:CCGGCGGAACGCAAAGTGGATGTATCTCGAGATACATCCACTTTGCGTTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008980.1-881s1c1
Sequence:CCGGCCATTGTTAGAAAGAAGGTTTCTCGAGAAACCTTCTTTCTAACAATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008980.1-2471s1c1
Sequence:CCGGCAGGAGTACATTGACGCCTTTCTCGAGAAAGGCGTCAATGTACTCCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008980.1-242s1c1
Sequence:CCGGCCCACCTATGTGACTACTGTTCTCGAGAACAGTAGTCACATAGGTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)