EMAIL THIS PAGE TO A FRIEND

PTPRC

protein tyrosine phosphatase, receptor type, C

312 Gene Product Result for
Synonyms: B220 CD45 CD45R GP180 L-CA LCA LY5 T200
UniProtKB ID: P08575, A8K7W6, Q16614, Q9H0Y6
Gene ID:
Human(5788) Summary: The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitosis, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus is classified as a receptor type PTP. This PTP has been shown to be an essential regulator of T- and B-cell antigen receptor signaling. It functions through either direct interaction with components of the antigen receptor complexes, or by activating various Src family kinases required for the antigen receptor signaling. This PTP also suppresses JAK kinases, and thus functions as a regulator of cytokine receptor signaling. Alternatively spliced transcripts variants of this gene, which encode distinct isoforms, have been reported. [provided by RefSeq, Jun 2012]
Mouse(19264) protein tyrosine phosphatase, receptor type, C
Rat(24699) protein tyrosine phosphatase, receptor type, C
Zebrafish(559154) protein tyrosine phosphatase, receptor type, C
Horse(100061950) protein tyrosine phosphatase, receptor type, C
domestic cat(101097123) protein tyrosine phosphatase, receptor type, C
chicken(386580) protein tyrosine phosphatase, receptor type, C
dog(490255) protein tyrosine phosphatase, receptor type, C
cow(407152) protein tyrosine phosphatase, receptor type, C
sheep(101102917) protein tyrosine phosphatase, receptor type, C
naked mole-rat(101710515) protein tyrosine phosphatase, receptor type, C
Domestic Rabbit(100358807) protein tyrosine phosphatase, receptor type, C
domestic guinea pig(100730564) protein tyrosine phosphatase, receptor type, C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA000440 Anti-CD45 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry, western blot pricing
SAB4502541 Anti-CD45 antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunofluorescence, immunohistochemistry pricing
SAB1306481 ANTI-CD45(C-TERMINAL) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing
SAB4504136 Anti-phospho-CD45 (pSer1007) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunofluorescence, western blot pricing
SAB4301489 Anti-phospho-CD45 (pSer1007) antibody produced in rabbit affinity isolated antibody human
western blot pricing
GW21465 Anti-PTPRC antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB4700471 Monoclonal Anti-CD45 antibody produced in mouse clone MEM-28, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
AMAB90518 Monoclonal Anti-CD45 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0159, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
AMAB90519 Monoclonal Anti-CD45 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0160, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB4700587 Monoclonal Anti-CD45 antibody produced in rat clone EM-05, purified immunoglobulin, buffered aqueous solution mouse
flow cytometry pricing
SAB4700474 Monoclonal Anti-CD45-APC antibody produced in mouse clone MEM-28, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700588 Monoclonal Anti-CD45-APC antibody produced in rat clone EM-05, purified immunoglobulin, buffered aqueous solution mouse
flow cytometry pricing
SAB4700477 Monoclonal Anti-CD45-Biotin antibody produced in mouse clone MEM-28, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700480 Monoclonal Anti-CD45-FITC antibody produced in mouse clone MEM-28, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
F8527 Monoclonal Anti-CD45−FITC/CD14-PE DUAL-TAG antibody produced in mouse clone BRA-55/UCHM-1, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700483 Monoclonal Anti-CD45-PE antibody produced in mouse clone MEM-28, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700589 Monoclonal Anti-CD45-PE antibody produced in rat clone EM-05, purified immunoglobulin, buffered aqueous solution mouse
flow cytometry pricing
SAB4700472 Monoclonal Anti-CD45RA antibody produced in mouse clone MEM-56, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700475 Monoclonal Anti-CD45RA-APC antibody produced in mouse clone MEM-56, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700478 Monoclonal Anti-CD45RA-Biotin antibody produced in mouse clone MEM-56, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
F1527 Monoclonal Anti-CD45RA−FITC antibody produced in mouse clone F8-11-13, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700481 Monoclonal Anti-CD45RA-FITC antibody produced in mouse clone MEM-56, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700484 Monoclonal Anti-CD45RA-PE antibody produced in mouse clone MEM-56, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700468 Monoclonal Anti-CD45RB antibody produced in mouse clone MEM-143, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700473 Monoclonal Anti-CD45RB antibody produced in mouse clone MEM-55, purified immunoglobulin, buffered aqueous solution human, nonhuman primates
flow cytometry pricing
SAB4700476 Monoclonal Anti-CD45RB-APC antibody produced in mouse clone MEM-55, purified immunoglobulin, buffered aqueous solution human, nonhuman primates
flow cytometry pricing
SAB4700482 Monoclonal Anti-CD45RB-FITC antibody produced in mouse clone MEM-55, purified immunoglobulin, buffered aqueous solution human, nonhuman primates
flow cytometry pricing
SAB4700485 Monoclonal Anti-CD45RB-PE antibody produced in mouse clone MEM-55, purified immunoglobulin, buffered aqueous solution nonhuman primates, human
flow cytometry pricing
C6555 Monoclonal Anti-CD45RO antibody produced in mouse clone UCHL-1, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
346616 1,2-Naphthoquinone 97% human pricing
156507 9,10-Phenanthrenequinone ≥99% human pricing
275034 9,10-Phenanthrenequinone 95% human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011210 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011210 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011210 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002838 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002838 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002838 MISSION® shRNA Lentiviral Transduction Particles human pricing

Related Products

Product # Description Species Add to Cart
 
MABF428 Anti-CD45.1 Antibody (mouse), APC, clone A20 This mouse monoclonal antibody Anti-CD45.1 (mouse), APC, clone A20 validated for use in IP, IHC & Flow Cytometry for the detection of CD45.1. pricing
MABF585 Anti-CD45.1 Antibody (mouse), APC, clone A20 This mouse monoclonal antibody Anti-CD45.1 (mouse), APC, clone A20 validated for use in IP, IHC & Flow Cytometry for the detection of CD45.1. pricing
MABF590 Anti-CD45.1 Antibody (mouse), APC-Cy7, clone A20 This mouse monoclonal antibody Anti-CD45.1 (mouse), APC-Cy7, clone A20 validated for use in IP, IHC & Flow Cytometry for the detection of CD45.1. pricing
MABF432 Anti-CD45.1 Antibody (mouse), clone A20 This Mouse Monoclonal Antibody Anti-CD45.1 (mouse), clone A20, Cat. No. MABF432 is validated for use in Immunoprecipitation, Immunohistochemistry, Flow Cytometry for the detection of CD45.1. pricing
MABF429 Anti-CD45.1 Antibody (mouse), FITC, clone A20 This mouse monoclonal antibody Anti-CD45.1 (mouse), FITC, clone A20 validated for use in IP, IHC & Flow Cytometry for the detection of CD45.1. pricing
MABF586 Anti-CD45.1 Antibody (mouse), FITC, clone A20 This mouse monoclonal antibody Anti-CD45.1 (mouse), FITC, clone A20 validated for use in IP, IHC & Flow Cytometry for the detection of CD45.1. pricing
MABF587 Anti-CD45.1 Antibody (mouse), FITC, clone A20 This mouse monoclonal antibody Anti-CD45.1 (mouse), FITC, clone A20 validated for use in IP, IHC & Flow Cytometry for the detection of CD45.1. pricing
MABF430 Anti-CD45.1 Antibody (mouse), PE, clone A20 This mouse monoclonal antibody Anti-CD45.1 (mouse), PE, clone A20 validated for use in IP, IHC & Flow Cytometry for the detection of CD45.1. pricing
MABF588 Anti-CD45.1 Antibody (mouse), PE, clone A20 This mouse monoclonal antibody Anti-CD45.1 (mouse), PE, clone A20 validated for use in IP, IHC & Flow Cytometry for the detection of CD45.1. pricing
MABF434 Anti-CD45.1 Antibody (mouse), PE-Cy7, clone A20 This mouse monoclonal antibody Anti-CD45.1 (mouse), PE-Cy7, clone A20 validated for use in IP, IHC & Flow Cytometry for the detection of CD45.1. pricing
MABF591 Anti-CD45.1 Antibody (mouse), PE-Cy7, clone A20 This mouse monoclonal antibody Anti-CD45.1 (mouse), PE-Cy7, clone A20 validated for use in IP, IHC & Flow Cytometry for the detection of CD45.1. pricing
MABF431 Anti-CD45.1 Antibody (mouse), PerCP-Cy5.5, clone A20 This mouse monoclonal antibody Anti-CD45.1 (mouse), PerCP-Cy5.5, clone A20 validated for use in IP, IHC & Flow Cytometry for the detection of CD45.1. pricing
MABF589 Anti-CD45.1 Antibody (mouse), PerCP-Cy5.5, clone A20 This mouse monoclonal antibody Anti-CD45.1 (mouse), PerCP-Cy5.5, clone A20 validated for use in IP, IHC & Flow Cytometry for the detection of CD45.1. pricing
MABF433 Anti-CD45.1 (mouse), APC-Cy7, clone A20 Antibody MABF433 is an antibody against CD45.1 for use in Immunoprecipitation, Immunohistochemistry, Flow Cytometry. pricing
MABF146E Anti-CD45.1 (Mouse), violetFluor™ 450, clone A20 Antibody Anti-CD45.1 (Mouse), violetFluor™ 450, clone A20 Antibody is an antibody against CD45.1 for use in Flow Cytometry. pricing
MABF435 Anti-CD45.2 Antibody (mouse), APC, clone 104 This mouse monoclonal antibody Anti-CD45.2 (mouse), APC, clone 104 validated for use in IP, Flow Cytometry & ICC for the detection of CD45.2. pricing
MABF594 Anti-CD45.2 Antibody (mouse), APC, clone 104 This mouse monoclonal antibody Anti-CD45.2 (mouse), APC, clone 104 validated for use in IP, Flow Cytometry & ICC for the detection of CD45.2. pricing
MABF436 Anti-CD45.2 Antibody (mouse), APC-Cy7, clone 104 This mouse monoclonal antibody Anti-CD45.2 (mouse), APC-Cy7, clone 104 validated for use in IP, Flow Cytometry & ICC for the detection of CD45.2. pricing
MABF595 Anti-CD45.2 Antibody (mouse), APC-Cy7, clone 104 This mouse monoclonal antibody Anti-CD45.2 (mouse), APC-Cy7, clone 104 validated for use in IP, Flow Cytometry & ICC for the detection of CD45.2. pricing
MABF441 Anti-CD45.2 Antibody (mouse), clone 104 This Mouse Monoclonal Antibody Anti-CD45.2 (mouse), clone 104, Cat. No. MABF441 is validated for use in Immunoprecipitation, Flow Cytometry, Immunocytochemistry for the detection of CD45.2. pricing
MABF437 Anti-CD45.2 Antibody (mouse), FITC, clone 104 This mouse monoclonal antibody Anti-CD45.2 (mouse), FITC, clone 104 validated for use in IP, Flow Cytometry, ICC & Immunofluorescence for the detection of CD45.2. pricing
MABF596 Anti-CD45.2 Antibody (mouse), FITC, clone 104 This mouse monoclonal antibody Anti-CD45.2 (mouse), FITC, clone 104 validated for use in IP, Flow Cytometry, ICC & Immunofluorescence for the detection of CD45.2. pricing
MABF597 Anti-CD45.2 Antibody (mouse), FITC, clone 104 This mouse monoclonal antibody Anti-CD45.2 (mouse), FITC, clone 104 validated for use in IP, Flow Cytometry, ICC & Immunofluorescence for the detection of CD45.2. pricing
MABF438 Anti-CD45.2 Antibody (mouse), PE, clone 104 This mouse monoclonal antibody Anti-CD45.2 (mouse), PE, clone 104 validated for use in IP, Flow Cytometry, ICC & Immunofluorescence for the detection of CD45.2. pricing
MABF598 Anti-CD45.2 Antibody (mouse), PE, clone 104 This mouse monoclonal antibody Anti-CD45.2 (mouse), PE, clone 104 validated for use in IP, Flow Cytometry, ICC & Immunofluorescence for the detection of CD45.2. pricing
MABF439 Anti-CD45.2 Antibody (mouse), PE-Cy7, clone 104 This mouse monoclonal antibody Anti-CD45.2 (mouse), PE-Cy7, clone 104 validated for use in IP, Flow Cytometry & ICC for the detection of CD45.2. pricing
MABF599 Anti-CD45.2 Antibody (mouse), PE-Cy7, clone 104 This mouse monoclonal antibody Anti-CD45.2 (mouse), PE-Cy7, clone 104 validated for use in IP, Flow Cytometry & ICC for the detection of CD45.2. pricing
MABF440 Anti-CD45.2 Antibody (mouse), PerCP-Cy5.5, clone 104 This mouse monoclonal antibody Anti-CD45.2 (mouse), PerCP-Cy5.5, clone 104 validated for use in IP, Flow Cytometry & ICC for the detection of CD45.2. pricing
MABF600 Anti-CD45.2 Antibody (mouse), PerCP-Cy5.5, clone 104 This mouse monoclonal antibody Anti-CD45.2 (mouse), PerCP-Cy5.5, clone 104 validated for use in IP, Flow Cytometry & ICC for the detection of CD45.2. pricing
MABF592 Anti-CD45.2 Antibody (mouse), violetFluor™ 450, clone 104 This mouse monoclonal antibody Anti-CD45.2 (mouse), violetFluor 450, clone 104 validated for use in IP, Flow Cytometry & ICC for the detection of CD45.2. pricing
MABF593 Anti-CD45.2 Antibody (mouse), violetFluor™ 450, clone 104 This mouse monoclonal antibody Anti-CD45.2 (mouse), violetFluor 450, clone 104 validated for use in IP, Flow Cytometry & ICC for the detection of CD45.2. pricing
MABF147C Anti-CD45.2 (Mouse), redFluor™ 710, clone 104 Antibody Anti-CD45.2 (Mouse), redFluor™ 710, clone 104 Antibody detects level of CD45.2 and has been published and validated for use in Flow Cytometry. pricing
05-1410-M Anti-CD45 Antibody, clone F10-89-4 Anti-CD45 Antibody, clone F10-89-4 detects level of CD45 & has been published & validated for use in FC, WB, IF, IP, IH(P). pricing
05-1410 Anti-CD45 Antibody, clone F10-89-4 Anti-CD45 Antibody, clone F10-89-4 detects level of CD45 & has been published & validated for use in FC, WB, IF, IP, IH(P). pricing
MABF323 Anti-CD45 (human) Antibody, AlexaFluor®488, clone HI30 Anti-CD45 (human) Antibody, AlexaFluor®488, clone HI30 is a highly specific mouse monoclonal antibody, that targets CD45 & has been tested in Flow Cytometry, IHC & western blotting. pricing
MABF160A Anti-CD45 (human), PerCP-Cy5.5, clone HI30 Antibody Anti-CD45 (human), PerCP-Cy5.5, clone HI30 Antibody is an antibody against CD45 for use in Flow Cytometry. pricing
MABF161B Anti-CD45 (human), redFluor™ 710, clone HI30 Antibody This mouse monoclonal Anti-CD45 Antibody (human), redFluor™ 710, clone HI30, Cat. No. MABF1612 is validated for use in Flow Cytometry, for the detection of CD45. pricing
MABF161A Anti-CD45 (human), violetFluor™ 450, clone HI30 Antibody This mouse monoclonal Anti-CD45 Antibody (human), violetFluor™ 450, clone HI30, Cat. No. MABF1610 is validated for use in Flow Cytometry, for the detection of CD45. pricing
MABF319 Anti-CD45 (mouse) Antibody, APC, clone 30-F11 Anti-CD45 (mouse) Antibody, APC, clone 30-F11 is a highly specific rat monoclonal antibody, that targets CD45 & has been tested in Flow Cytometry, IHC, western blotting & IP. pricing
MABF320 Anti-CD45 (mouse) Antibody, FITC, clone 30-F11 Anti-CD45 (mouse) Antibody, FITC, clone 30-F11 is a highly specific rat monoclonal antibody, that targets CD45 & has been tested in Flow Cytometry, IHC, western blotting & IP. pricing
MABF321 Anti-CD45 (mouse) Antibody, PE, clone 30-F11 Anti-CD45 (mouse) Antibody, PE, clone 30-F11 is a highly specific rat monoclonal antibody, that targets CD45 & has been tested in Flow Cytometry, IHC, Activity Assay, IP & western blotting. pricing
MABF322 Anti-CD45 (mouse) Antibody, PE/Cy5, clone 30-F11 Anti-CD45 (mouse) Antibody, PE/Cy5, clone 30-F11 is a highly specific rat monoclonal antibody, that targets CD45 & has been tested in Flow Cytometry, IHC, western blotting & IP. pricing
MABF1466 Anti-CD45 (Mouse), clone 30-F11 Antibody This rat monoclonal Anti-CD45 Antibody (Mouse), clone 30-F11, Cat. No. MABF1466 is validated for use in Flow Cytometry, for the detection of CD45. pricing
MABF146C Anti-CD45 (Mouse), PE-Cy7, clone 30-F11 Antibody This rat monoclonal Anti-CD45 Antibody (Mouse), PE-Cy7, clone 30-F11, Cat. No. MABF1465 is validated for use in Flow Cytometry, for the detection of CD45. pricing
MABF1471 Anti-CD45 (Mouse), redFluor™ 710, clone 30-F11 Antibody Anti-CD45 (Mouse), redFluor™ 710, clone 30-F11 Antibody is an antibody against CD45 for use in Flow Cytometry. pricing
MABF1472 Anti-CD45 (Mouse), redFluor™ 710, clone 30-F11 Antibody Anti-CD45 (Mouse), redFluor™ 710, clone 30-F11 Antibody is an antibody against CD45 for use in Flow Cytometry. pricing
MABF442 Anti-CD45R (B220) Antibody (human/mouse), Biotin, clone RA3-6B2 This rat monoclonal antibody Anti-CD45R (B220) (human/mouse), Biotin, clone RA3-6B2 validated for use in western blotting, IP, IHC, Immunofluorescence & Flow Cytometry for the detection of CD45R (B220). pricing
MABF601 Anti-CD45R (B220) Antibody (human/mouse), Biotin, clone RA3-6B2 This rat monoclonal antibody Anti-CD45R (B220) (human/mouse), Biotin, clone RA3-6B2 validated for use in western blotting, IP, IHC, Immunofluorescence & Flow Cytometry for the detection of CD45R (B220). pricing
MABF447 Anti-CD45R (B220) Antibody (human/mouse), FITC, clone RA3-6B2 This rat monoclonal antibody Anti-CD45R (B220) (human/mouse), FITC, clone RA3-6B2 validated for use in western blotting, IP, IHC, Immunofluorescence & Flow Cytometry for the detection of CD45R (B220). pricing
MABF608 Anti-CD45R (B220) Antibody (human/mouse), FITC, clone RA3-6B2 This rat monoclonal antibody Anti-CD45R (B220) (human/mouse), FITC, clone RA3-6B2 validated for use in western blotting, IP, IHC, Immunofluorescence & Flow Cytometry for the detection of CD45R (B220). pricing
MABF443 Anti-CD45R (B220) Antibody (human/mouse), PE, clone RA3-6B2 This rat monoclonal antibody Anti-CD45R (B220) (human/mouse), PE, clone RA3-6B2 validated for use in western blotting, IP, IHC, Immunofluorescence & Flow Cytometry for the detection of CD45R (B220). pricing
MABF602 Anti-CD45R (B220) Antibody (human/mouse), PE, clone RA3-6B2 This rat monoclonal antibody Anti-CD45R (B220) (human/mouse), PE, clone RA3-6B2 validated for use in western blotting, IP, IHC, Immunofluorescence & Flow Cytometry for the detection of CD45R (B220). pricing
MABF444 Anti-CD45R (B220) Antibody (human/mouse), PE-Cy5, clone RA3-6B2 This rat monoclonal antibody Anti-CD45R (B220) (human/mouse), PE-Cy5, clone RA3-6B2 validated for use in western blotting, IP, IHC, Immunofluorescence & Flow Cytometry for the detection of CD45R (B220). pricing
MABF603 Anti-CD45R (B220) Antibody (human/mouse), PE-Cy5, clone RA3-6B2 This rat monoclonal antibody Anti-CD45R (B220) (human/mouse), PE-Cy5, clone RA3-6B2 validated for use in western blotting, IP, IHC, Immunofluorescence & Flow Cytometry for the detection of CD45R (B220). pricing
MABF445 Anti-CD45R (B220) Antibody (human/mouse), PE-Cy7, clone RA3-6B2 This rat monoclonal antibody Anti-CD45R (B220) (human/mouse), PE-Cy7, clone RA3-6B2 validated for use in western blotting, IP, IHC, Immunofluorescence & Flow Cytometry for the detection of CD45R (B220). pricing
MABF604 Anti-CD45R (B220) Antibody (human/mouse), PE-Cy7, clone RA3-6B2 This rat monoclonal antibody Anti-CD45R (B220) (human/mouse), PE-Cy7, clone RA3-6B2 validated for use in western blotting, IP, IHC, Immunofluorescence & Flow Cytometry for the detection of CD45R (B220). pricing
MABF605 Anti-CD45R (B220) Antibody (human/mouse), PerCP-Cy5.5, clone RA3-6B2 This rat monoclonal antibody Anti-CD45R (B220) (human/mouse), PerCP-Cy5.5, clone RA3-6B2 validated for use in western blotting, IP, IHC, Immunofluorescence & Flow Cytometry for the detection of CD45R (B220). pricing
MABF606 Anti-CD45R (B220) Antibody (human/mouse), violetFluor™ 450, clone RA3-6B2 This rat monoclonal antibody Anti-CD45R (B220) (human/mouse), violetFluor 450, clone RA3-6B2 validated for use in western blotting, IP, IHC, Immunofluorescence & Flow Cytometry for the detection of CD45R (B220). pricing
MABF607 Anti-CD45R (B220) Antibody (human/mouse), violetFluor™ 450, clone RA3-6B2 This rat monoclonal antibody Anti-CD45R (B220) (human/mouse), violetFluor 450, clone RA3-6B2 validated for use in western blotting, IP, IHC, Immunofluorescence & Flow Cytometry for the detection of CD45R (B220). pricing
MABF446 Anti-CD45R (B220) (human/mouse), PerCP-Cy5.5, clone RA3-6B2 Antibody MABF446 is an antibody against CD45R for use in Flow Cytometry. pricing
MABF147B Anti-CD45R (B220) (human/mouse), redFluor™ 710, clone RA3-6B2 Antibody Anti-CD45R (B220) (human/mouse), redFluor™ 710, clone RA3-6B2 Antibody detects level of CD45R and has been published and validated for use in Flow Cytometry. pricing
05-1413 Anti-CD45RA Antibody, Clone MEM 56 Anti-CD45RA Antibody, Clone MEM 56 detects level of CD45RA & has been published & validated for use in FC, IF, IH(P), IP & WB. pricing
MABF448 Anti-CD45RA Antibody (human), PE-Cy7, clone HI100 This mouse monoclonal antibody Anti-CD45RA (human), PE-Cy7, clone HI100 validated for use in western blotting, IHC & Flow Cytometry for the detection of CD45RA. pricing
MABF609 Anti-CD45RA Antibody (human), PE-Cy7, clone HI100 This mouse monoclonal antibody Anti-CD45RA (human), PE-Cy7, clone HI100 validated for use in western blotting, IHC & Flow Cytometry for the detection of CD45RA. pricing
MABF449 Anti-CD45RA Antibody (human), PerCP-Cy5.5, clone HI100 This mouse monoclonal antibody Anti-CD45RA (human), PerCP-Cy5.5, clone HI100 validated for use in western blotting, IHC & Flow Cytometry for the detection of CD45RA. pricing
MABF610 Anti-CD45RA Antibody (human), PerCP-Cy5.5, clone HI100 This mouse monoclonal antibody Anti-CD45RA (human), PerCP-Cy5.5, clone HI100 validated for use in western blotting, IHC & Flow Cytometry for the detection of CD45RA. pricing
MABF355 Anti-CD45RO (human) Antibody, APC, clone UCHL1 Detect CD45RO using this mouse monoclonal antibody, Anti-CD45RO (human) Antibody, APC, clone UCHL1 validated for use in Flow Cytometry, western blotting, IHC & IP. pricing
MABF356 Anti-CD45RO (human) Antibody, FITC, clone UCHL1 Anti-CD45RO (human) Antibody, FITC, clone UCHL1 is a highly specific mouse monoclonal antibody, that targets CD45RO & has been tested in Flow Cytometry, western blotting, IHC & IP. pricing
MABF357 Anti-CD45RO (human) Antibody, PE, clone UCHL1 Detect CD45RO using this mouse monoclonal antibody, Anti-CD45RO (human) Antibody, PE, clone UCHL1 validated for use in Flow Cytometry, western blotting, IHC & IP. pricing
MABF358 Anti-CD45RO (human) Antibody, PE/Cy5, clone UCHL1 Detect CD45RO using this mouse monoclonal antibody, Anti-CD45RO (human) Antibody, PE/Cy5, clone UCHL1 validated for use in Flow Cytometry, western blotting, IHC & IP. pricing
14-618-M CD45 Protein, 10 µg His6-tagged, recombinant, human CD45, amino acids 598-end, for use in Enzyme Assays. pricing
FCMAB228F Milli-Mark™ Anti-mouse CD45R (B220)-FITC Antibody, clone RA3-3A1/6.1 Milli-Mark Anti-mouse CD45R (B220)-FITC Antibody, clone RA3-3A1/6.1 is an antibody against mouse CD45R (B220) for use in FC. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002838 Rosetta Predictions human pricing
NM_080921 Rosetta Predictions human pricing
NM_080922 Rosetta Predictions human pricing
NM_080923 Rosetta Predictions human pricing
NM_001109887 Rosetta Predictions rat pricing
NM_001109888 Rosetta Predictions rat pricing
NM_001109889 Rosetta Predictions rat pricing
NM_001109890 Rosetta Predictions rat pricing
NM_138507 Rosetta Predictions rat pricing
NM_001111316 Rosetta Predictions mouse pricing
NM_011210 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002838 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116570 predicted 1847
2 SASI_Hs01_00116571 predicted 3656
3 SASI_Hs01_00116572 predicted 2765
4 SASI_Hs01_00116573 predicted 3098
5 SASI_Hs02_00334566 predicted 2551
6 SASI_Hs01_00116574 predicted 1754
7 SASI_Hs01_00116575 predicted 3581
8 SASI_Hs01_00116576 predicted 1903
9 SASI_Hs01_00116577 predicted 4116
10 SASI_Hs01_00116578 predicted 3460
11 SASI_Hs01_00116579 predicted 3125
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080921 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079419 predicted 1361
2 SASI_Hs01_00079420 predicted 3173
3 SASI_Hs01_00079421 predicted 2276
4 SASI_Hs01_00079422 predicted 2624
5 SASI_Hs02_00362689 predicted 2064
6 SASI_Hs01_00079423 predicted 1266
7 SASI_Hs01_00079424 predicted 3105
8 SASI_Hs01_00079425 predicted 1425
9 SASI_Hs01_00079426 predicted 3635
10 SASI_Hs01_00079427 predicted 2980
11 SASI_Hs01_00079428 predicted 2636
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080922 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114926 predicted 1708
2 SASI_Hs01_00114927 predicted 3505
3 SASI_Hs01_00114928 predicted 2613
4 SASI_Hs01_00114929 predicted 2958
5 SASI_Hs02_00362690 predicted 2407
6 SASI_Hs01_00114930 predicted 1611
7 SASI_Hs01_00114931 predicted 3436
8 SASI_Hs01_00114932 predicted 1763
9 SASI_Hs01_00114933 predicted 3970
10 SASI_Hs01_00114934 predicted 3313
11 SASI_Hs01_00114935 predicted 2981
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080923 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019762 predicted 516
2 SASI_Hs01_00019763 predicted 627
3 SASI_Hs01_00019764 predicted 664
4 SASI_Hs01_00019765 predicted 516
5 SASI_Hs01_00019766 predicted 230
6 SASI_Hs01_00019767 predicted 769
7 SASI_Hs01_00019768 predicted 435
8 SASI_Hs01_00019769 predicted 450
9 SASI_Hs01_00019770 predicted 211
10 SASI_Hs01_00019771 predicted 649
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109887 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250712 predicted 1366
2 SASI_Rn02_00250713 predicted 739
3 SASI_Rn02_00250714 predicted 1189
4 SASI_Rn02_00250715 predicted 1382
5 SASI_Rn02_00250716 predicted 1476
6 SASI_Rn02_00250717 predicted 1410
7 SASI_Rn02_00250718 predicted 3410
8 SASI_Rn02_00250719 predicted 699
9 SASI_Rn02_00250720 predicted 3061
10 SASI_Rn02_00250721 predicted 1400
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109888 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250722 predicted 1344
2 SASI_Rn02_00250723 predicted 724
3 SASI_Rn02_00250724 predicted 1172
4 SASI_Rn02_00250725 predicted 1361
5 SASI_Rn02_00250726 predicted 1452
6 SASI_Rn02_00250727 predicted 1396
7 SASI_Rn02_00250728 predicted 3398
8 SASI_Rn02_00250729 predicted 684
9 SASI_Rn02_00250730 predicted 3040
10 SASI_Rn02_00250731 predicted 1380
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109889 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250732 predicted 1344
2 SASI_Rn02_00250733 predicted 722
3 SASI_Rn02_00250734 predicted 1164
4 SASI_Rn02_00250735 predicted 1354
5 SASI_Rn02_00250736 predicted 1450
6 SASI_Rn02_00250737 predicted 1388
7 SASI_Rn02_00250738 predicted 3393
8 SASI_Rn02_00250739 predicted 677
9 SASI_Rn02_00250740 predicted 3042
10 SASI_Rn02_00250741 predicted 1380
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109890 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250742 predicted 1214
2 SASI_Rn02_00250743 predicted 598
3 SASI_Rn02_00250744 predicted 1048
4 SASI_Rn02_00250745 predicted 1230
5 SASI_Rn02_00250746 predicted 1325
6 SASI_Rn02_00250747 predicted 1270
7 SASI_Rn02_00250748 predicted 3264
8 SASI_Rn02_00250749 predicted 555
9 SASI_Rn02_00250750 predicted 2912
10 SASI_Rn02_00250751 predicted 1248
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138507 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268098 predicted 1614
2 SASI_Rn02_00268099 predicted 991
3 SASI_Rn02_00268100 predicted 1442
4 SASI_Rn02_00268101 predicted 1625
5 SASI_Rn02_00268102 predicted 1728
6 SASI_Rn02_00268103 predicted 1665
7 SASI_Rn02_00268104 predicted 3668
8 SASI_Rn02_00268105 predicted 952
9 SASI_Rn02_00268106 predicted 3315
10 SASI_Rn02_00268107 predicted 1648
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111316 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306792 predicted 978
2 SASI_Mm02_00306793 predicted 1740
3 SASI_Mm02_00306794 predicted 2860
4 SASI_Mm02_00306795 predicted 2429
5 SASI_Mm02_00306796 predicted 1414
6 SASI_Mm02_00306797 predicted 2520
7 SASI_Mm02_00306798 predicted 3021
8 SASI_Mm02_00306799 predicted 1371
9 SASI_Mm02_00306800 predicted 3739
10 SASI_Mm02_00306801 predicted 1726
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011210 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047754 predicted 560
2 SASI_Mm01_00047755 predicted 1325
3 SASI_Mm01_00047758 predicted 2442
4 SASI_Mm01_00047759 predicted 2005
5 SASI_Mm02_00320151 predicted 997
6 SASI_Mm01_00047760 predicted 2108
7 SASI_Mm01_00047762 predicted 2597
8 SASI_Mm01_00047763 predicted 962
9 SASI_Mm02_00320152 predicted 3327
10 SASI_Mm01_00047761 predicted 1312
11 SASI_Mm01_00047756 predicted 328
12 SASI_Mm01_00047757 predicted 1271
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011210
PTPRC MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase, receptor type, C
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000340019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011210.3-1026s21c1
Sequence:CCGGGAAAGCTTGAAACCTTATAAACTCGAGTTTATAAGGTTTCAAGCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340020    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011210.3-3706s21c1
Sequence:CCGGTCACCTTTGCCACTGTATAAACTCGAGTTTATACAGTGGCAAAGGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011210.3-1792s21c1
Sequence:CCGGATGCAGGGTCCACCTACATAACTCGAGTTATGTAGGTGGACCCTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011210.3-2183s21c1
Sequence:CCGGCAAACTTCGACGGAGAGTTAACTCGAGTTAACTCTCCGTCGAAGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011210.3-360s21c1
Sequence:CCGGTACACCTATGAATCTAGTAATCTCGAGATTACTAGATTCATAGGTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011210.1-1969s1c1
Sequence:CCGGCGGGCTTTCAAAGATATTGTTCTCGAGAACAATATCTTTGAAAGCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011210.1-2347s1c1
Sequence:CCGGGCACAGTATATCCTGATTCATCTCGAGATGAATCAGGATATACTGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011210.1-960s1c1
Sequence:CCGGGCCTAATAATGTGACCAGTTTCTCGAGAAACTGGTCACATTATTAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011210.1-3188s1c1
Sequence:CCGGCCTTGTTCAATCTCTTGGAAACTCGAGTTTCCAAGAGATTGAACAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011210.1-292s1c1
Sequence:CCGGGCTGCCATGTTTGGGAACATTCTCGAGAATGTTCCCAAACATGGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011210
PTPRC MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase, receptor type, C
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000340019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011210.3-1026s21c1
Sequence:CCGGGAAAGCTTGAAACCTTATAAACTCGAGTTTATAAGGTTTCAAGCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340020    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011210.3-3706s21c1
Sequence:CCGGTCACCTTTGCCACTGTATAAACTCGAGTTTATACAGTGGCAAAGGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011210.3-1792s21c1
Sequence:CCGGATGCAGGGTCCACCTACATAACTCGAGTTATGTAGGTGGACCCTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011210.3-2183s21c1
Sequence:CCGGCAAACTTCGACGGAGAGTTAACTCGAGTTAACTCTCCGTCGAAGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011210.3-360s21c1
Sequence:CCGGTACACCTATGAATCTAGTAATCTCGAGATTACTAGATTCATAGGTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011210.1-1969s1c1
Sequence:CCGGCGGGCTTTCAAAGATATTGTTCTCGAGAACAATATCTTTGAAAGCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011210.1-2347s1c1
Sequence:CCGGGCACAGTATATCCTGATTCATCTCGAGATGAATCAGGATATACTGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011210.1-960s1c1
Sequence:CCGGGCCTAATAATGTGACCAGTTTCTCGAGAAACTGGTCACATTATTAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011210.1-3188s1c1
Sequence:CCGGCCTTGTTCAATCTCTTGGAAACTCGAGTTTCCAAGAGATTGAACAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011210.1-292s1c1
Sequence:CCGGGCTGCCATGTTTGGGAACATTCTCGAGAATGTTCCCAAACATGGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011210
PTPRC MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase, receptor type, C
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000340019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011210.3-1026s21c1
Sequence:CCGGGAAAGCTTGAAACCTTATAAACTCGAGTTTATAAGGTTTCAAGCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340020    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011210.3-3706s21c1
Sequence:CCGGTCACCTTTGCCACTGTATAAACTCGAGTTTATACAGTGGCAAAGGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011210.3-1792s21c1
Sequence:CCGGATGCAGGGTCCACCTACATAACTCGAGTTATGTAGGTGGACCCTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011210.3-2183s21c1
Sequence:CCGGCAAACTTCGACGGAGAGTTAACTCGAGTTAACTCTCCGTCGAAGTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011210.3-360s21c1
Sequence:CCGGTACACCTATGAATCTAGTAATCTCGAGATTACTAGATTCATAGGTGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011210.1-1969s1c1
Sequence:CCGGCGGGCTTTCAAAGATATTGTTCTCGAGAACAATATCTTTGAAAGCCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011210.1-2347s1c1
Sequence:CCGGGCACAGTATATCCTGATTCATCTCGAGATGAATCAGGATATACTGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011210.1-960s1c1
Sequence:CCGGGCCTAATAATGTGACCAGTTTCTCGAGAAACTGGTCACATTATTAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011210.1-3188s1c1
Sequence:CCGGCCTTGTTCAATCTCTTGGAAACTCGAGTTTCCAAGAGATTGAACAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011210.1-292s1c1
Sequence:CCGGGCTGCCATGTTTGGGAACATTCTCGAGAATGTTCCCAAACATGGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002838
VALIDATED
PTPRC MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase, receptor type, C
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002838.3-3118s21c1
Sequence:GTACCGGTATAACAGAGTGCCACTTAAACTCGAGTTTAAGTGGCACTCTGTTATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230687    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002838.3-4576s21c1
Sequence:CCGGCTCCTTGTTCTACTCATATATCTCGAGATATATGAGTAGAACAAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002838.3-1779s21c1
Sequence:CCGGGAATTGCGATTTCCGTGTAAACTCGAGTTTACACGGAAATCGCAATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002838.3-1276s21c1
Sequence:CCGGGACTCAGAAATACTCTATAATCTCGAGATTATAGAGTATTTCTGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002838.3-1251s21c1
Sequence:CCGGTGAACCCGAACATGAGTATAACTCGAGTTATACTCATGTTCGGGTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_002838.x-1296s1c1
Sequence:CCGGGCTGCACATCAAGGAGTAATTCTCGAGAATTACTCCTTGATGTGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002838.x-318s1c1
Sequence:CCGGCCAGACAATACTTCCACCCAACTCGAGTTGGGTGGAAGTATTGTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_002838.x-556s1c1
Sequence:CCGGCCTTTCCTACAGACCCAGTTTCTCGAGAAACTGGGTCTGTAGGAAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002849    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002838.x-4727s1c1
Sequence:CCGGGCTCGATTATTCCCTGTACAACTCGAGTTGTACAGGGAATAATCGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_002838.x-2193s1c1
Sequence:CCGGGCAGGGTCAAACTACATAAATCTCGAGATTTATGTAGTTTGACCCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002838
VALIDATED
PTPRC MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase, receptor type, C
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002838.3-3118s21c1
Sequence:GTACCGGTATAACAGAGTGCCACTTAAACTCGAGTTTAAGTGGCACTCTGTTATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230687    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002838.3-4576s21c1
Sequence:CCGGCTCCTTGTTCTACTCATATATCTCGAGATATATGAGTAGAACAAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002838.3-1779s21c1
Sequence:CCGGGAATTGCGATTTCCGTGTAAACTCGAGTTTACACGGAAATCGCAATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002838.3-1276s21c1
Sequence:CCGGGACTCAGAAATACTCTATAATCTCGAGATTATAGAGTATTTCTGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002838.3-1251s21c1
Sequence:CCGGTGAACCCGAACATGAGTATAACTCGAGTTATACTCATGTTCGGGTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_002838.x-1296s1c1
Sequence:CCGGGCTGCACATCAAGGAGTAATTCTCGAGAATTACTCCTTGATGTGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002838.x-318s1c1
Sequence:CCGGCCAGACAATACTTCCACCCAACTCGAGTTGGGTGGAAGTATTGTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_002838.x-556s1c1
Sequence:CCGGCCTTTCCTACAGACCCAGTTTCTCGAGAAACTGGGTCTGTAGGAAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002849    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002838.x-4727s1c1
Sequence:CCGGGCTCGATTATTCCCTGTACAACTCGAGTTGTACAGGGAATAATCGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_002838.x-2193s1c1
Sequence:CCGGGCAGGGTCAAACTACATAAATCTCGAGATTTATGTAGTTTGACCCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002838
VALIDATED
PTPRC MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase, receptor type, C
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002838.3-3118s21c1
Sequence:GTACCGGTATAACAGAGTGCCACTTAAACTCGAGTTTAAGTGGCACTCTGTTATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230687    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002838.3-4576s21c1
Sequence:CCGGCTCCTTGTTCTACTCATATATCTCGAGATATATGAGTAGAACAAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002838.3-1779s21c1
Sequence:CCGGGAATTGCGATTTCCGTGTAAACTCGAGTTTACACGGAAATCGCAATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002838.3-1276s21c1
Sequence:CCGGGACTCAGAAATACTCTATAATCTCGAGATTATAGAGTATTTCTGAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002838.3-1251s21c1
Sequence:CCGGTGAACCCGAACATGAGTATAACTCGAGTTATACTCATGTTCGGGTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_002838.x-1296s1c1
Sequence:CCGGGCTGCACATCAAGGAGTAATTCTCGAGAATTACTCCTTGATGTGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002838.x-318s1c1
Sequence:CCGGCCAGACAATACTTCCACCCAACTCGAGTTGGGTGGAAGTATTGTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_002838.x-556s1c1
Sequence:CCGGCCTTTCCTACAGACCCAGTTTCTCGAGAAACTGGGTCTGTAGGAAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002849    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002838.x-4727s1c1
Sequence:CCGGGCTCGATTATTCCCTGTACAACTCGAGTTGTACAGGGAATAATCGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_002838.x-2193s1c1
Sequence:CCGGGCAGGGTCAAACTACATAAATCTCGAGATTTATGTAGTTTGACCCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)