EMAIL THIS PAGE TO A FRIEND

PTPRD

protein tyrosine phosphatase, receptor type, D

374 Gene Product Result for
Synonyms: HPTP HPTPD HPTPDELTA PTPD RPTPDELTA
UniProtKB ID: P23468, B1ALA0, Q3KPJ0, Q3KPJ1, Q3KPJ2
Gene ID:
Human(5789) Summary: The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an extracellular region, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region of this protein is composed of three Ig-like and eight fibronectin type III-like domains. Studies of the similar genes in chicken and fly suggest the role of this PTP is in promoting neurite growth, and regulating neurons axon guidance. Multiple alternatively spliced transcript variants of this gene have been reported. A related pseudogene has been identified on chromosome 5. [provided by RefSeq, Jan 2010]
Mouse(19266) protein tyrosine phosphatase, receptor type, D
Rat(313278) protein tyrosine phosphatase, receptor type, D
Zebrafish(100330629) protein tyrosine phosphatase, receptor type, D
chicken(431602) protein tyrosine phosphatase, receptor type, D
domestic cat(101094634) protein tyrosine phosphatase, receptor type, D
Horse(100051885) protein tyrosine phosphatase, receptor type, D
dog(481538) protein tyrosine phosphatase, receptor type, D
cow(532751) protein tyrosine phosphatase, receptor type, D
sheep(101118505) protein tyrosine phosphatase, receptor type, D
naked mole-rat(101699982) protein tyrosine phosphatase, receptor type, D
Domestic Rabbit(100354082) protein tyrosine phosphatase, receptor type, D
domestic guinea pig(100719145) protein tyrosine phosphatase, receptor type, D
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002839 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002839 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002839 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011211 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011211 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011211 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU077591 MISSION® esiRNA esiRNA human PTPRD (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040712 Rosetta Predictions human pricing
NM_002839 Rosetta Predictions human pricing
NM_130391 Rosetta Predictions human pricing
NM_130392 Rosetta Predictions human pricing
NM_130393 Rosetta Predictions human pricing
XM_001067936 Rosetta Predictions rat pricing
XM_233065 Rosetta Predictions rat pricing
NM_001014288 Rosetta Predictions mouse pricing
NM_011211 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040712 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309129 predicted 3032
2 SASI_Hs02_00309130 predicted 1844
3 SASI_Hs02_00309131 predicted 2124
4 SASI_Hs02_00309132 predicted 3917
5 SASI_Hs02_00309133 predicted 3948
6 SASI_Hs02_00309134 predicted 4456
7 SASI_Hs02_00309135 predicted 3622
8 SASI_Hs02_00309136 predicted 2976
9 SASI_Hs02_00309137 predicted 3957
10 SASI_Hs02_00309138 predicted 3873
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002839 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00334567 predicted 4270
2 SASI_Hs01_00088625 predicted 1849
3 SASI_Hs01_00088626 predicted 2134
4 SASI_Hs01_00088627 predicted 5148
5 SASI_Hs01_00088628 predicted 5184
6 SASI_Hs01_00088629 predicted 5681
7 SASI_Hs01_00088630 predicted 4845
8 SASI_Hs01_00088631 predicted 4215
9 SASI_Hs01_00088633 predicted 5186
10 SASI_Hs02_00334568 predicted 5104
11 SASI_Hs01_00088624 predicted 5744
12 SASI_Hs01_00088632 predicted 4109
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130391 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00362720 predicted 4240
2 SASI_Hs01_00203165 predicted 1815
3 SASI_Hs01_00203166 predicted 2093
4 SASI_Hs01_00203167 predicted 5105
5 SASI_Hs01_00203168 predicted 5143
6 SASI_Hs01_00203169 predicted 5647
7 SASI_Hs01_00203170 predicted 4813
8 SASI_Hs01_00203171 predicted 4179
9 SASI_Hs01_00203173 predicted 5149
10 SASI_Hs02_00362721 predicted 5062
11 SASI_Hs01_00203164 predicted 5712
12 SASI_Hs01_00203172 predicted 4064
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130392 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00362722 predicted 4252
2 SASI_Hs01_00017245 predicted 1856
3 SASI_Hs01_00017246 predicted 2132
4 SASI_Hs01_00017247 predicted 5124
5 SASI_Hs01_00017248 predicted 5152
6 SASI_Hs01_00017249 predicted 5663
7 SASI_Hs01_00017250 predicted 4823
8 SASI_Hs01_00017251 predicted 4193
9 SASI_Hs01_00017253 predicted 5165
10 SASI_Hs02_00362723 predicted 5081
11 SASI_Hs01_00017244 predicted 5717
12 SASI_Hs01_00017252 predicted 4081
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130393 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00362724 predicted 3037
2 SASI_Hs01_00108887 predicted 1853
3 SASI_Hs01_00108888 predicted 2134
4 SASI_Hs01_00108889 predicted 3913
5 SASI_Hs01_00108890 predicted 3946
6 SASI_Hs01_00108891 predicted 4455
7 SASI_Hs01_00108892 predicted 3621
8 SASI_Hs01_00108893 predicted 2988
9 SASI_Hs01_00108895 predicted 3953
10 SASI_Hs02_00362725 predicted 3872
11 SASI_Hs01_00108886 predicted 4509
12 SASI_Hs01_00108894 predicted 2869
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067936 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00322873 predicted 702
2 SASI_Rn02_00322874 predicted 727
3 SASI_Rn02_00322875 predicted 713
4 SASI_Rn02_00322876 predicted 1077
5 SASI_Rn02_00322877 predicted 3158
6 SASI_Rn02_00322878 predicted 2791
7 SASI_Rn02_00322879 predicted 633
8 SASI_Rn02_00322880 predicted 1250
9 SASI_Rn02_00322881 predicted 2196
10 SASI_Rn02_00322882 predicted 2983
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_233065 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387384 predicted 4726
2 SASI_Rn02_00387385 predicted 538
3 SASI_Rn02_00387386 predicted 1625
4 SASI_Rn02_00387387 predicted 2619
5 SASI_Rn02_00387388 predicted 2253
6 SASI_Rn02_00387389 predicted 1988
7 SASI_Rn02_00387390 predicted 716
8 SASI_Rn02_00387391 predicted 2436
9 SASI_Rn02_00387392 predicted 792
10 SASI_Rn02_00387393 predicted 1665
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014288 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034657 predicted 577
2 SASI_Mm01_00034659 predicted 1840
3 SASI_Mm01_00034660 predicted 1692
4 SASI_Mm01_00034661 predicted 871
5 SASI_Mm01_00034662 predicted 909
6 SASI_Mm01_00034664 predicted 2693
7 SASI_Mm02_00287416 predicted 1151
8 SASI_Mm01_00034665 predicted 3558
9 SASI_Mm01_00034666 predicted 861
10 SASI_Mm02_00287417 predicted 2163
11 SASI_Mm01_00034658 predicted 3207
12 SASI_Mm01_00034663 predicted 1291
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011211 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00189819 predicted 1258
2 SASI_Mm01_00189821 predicted 2523
3 SASI_Mm01_00189822 predicted 2376
4 SASI_Mm01_00189823 predicted 1553
5 SASI_Mm01_00189824 predicted 1592
6 SASI_Mm01_00189826 predicted 3376
7 SASI_Mm02_00320153 predicted 1837
8 SASI_Mm01_00189827 predicted 4239
9 SASI_Mm01_00189828 predicted 1547
10 SASI_Mm02_00320154 predicted 2848
11 SASI_Mm01_00189820 predicted 3898
12 SASI_Mm01_00189825 predicted 1972
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002839
PTPRD MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase, receptor type, D
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000355692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002839.2-1859s21c1
Sequence:CCGGTAAGTCCCTACTCGGATTATGCTCGAGCATAATCCGAGTAGGGACTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002839.2-3669s21c1
Sequence:CCGGAGATACCACATACGATGTAAACTCGAGTTTACATCGTATGTGGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002839.2-1361s21c1
Sequence:CCGGATTCCGCTCCTGCCAATTTATCTCGAGATAAATTGGCAGGAGCGGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002850    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002839.x-6082s1c1
Sequence:CCGGCTTCCCACCATACTGCTCATACTCGAGTATGAGCAGTATGGTGGGAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002839.x-4297s1c1
Sequence:CCGGCCAAAGAATAGATACGCGAATCTCGAGATTCGCGTATCTATTCTTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002839.x-5143s1c1
Sequence:CCGGGCCAATCTTCCATGTAATAAACTCGAGTTTATTACATGGAAGATTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002839.x-1729s1c1
Sequence:CCGGCCTGAGTCTGAAACAAGTATTCTCGAGAATACTTGTTTCAGACTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002839.x-873s1c1
Sequence:CCGGCCCACCCACTAATCATGAAATCTCGAGATTTCATGATTAGTGGGTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002839
PTPRD MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase, receptor type, D
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000355692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002839.2-1859s21c1
Sequence:CCGGTAAGTCCCTACTCGGATTATGCTCGAGCATAATCCGAGTAGGGACTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002839.2-3669s21c1
Sequence:CCGGAGATACCACATACGATGTAAACTCGAGTTTACATCGTATGTGGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002839.2-1361s21c1
Sequence:CCGGATTCCGCTCCTGCCAATTTATCTCGAGATAAATTGGCAGGAGCGGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002850    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002839.x-6082s1c1
Sequence:CCGGCTTCCCACCATACTGCTCATACTCGAGTATGAGCAGTATGGTGGGAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002839.x-4297s1c1
Sequence:CCGGCCAAAGAATAGATACGCGAATCTCGAGATTCGCGTATCTATTCTTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002839.x-5143s1c1
Sequence:CCGGGCCAATCTTCCATGTAATAAACTCGAGTTTATTACATGGAAGATTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002839.x-1729s1c1
Sequence:CCGGCCTGAGTCTGAAACAAGTATTCTCGAGAATACTTGTTTCAGACTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002839.x-873s1c1
Sequence:CCGGCCCACCCACTAATCATGAAATCTCGAGATTTCATGATTAGTGGGTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002839
PTPRD MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase, receptor type, D
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000355692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002839.2-1859s21c1
Sequence:CCGGTAAGTCCCTACTCGGATTATGCTCGAGCATAATCCGAGTAGGGACTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002839.2-3669s21c1
Sequence:CCGGAGATACCACATACGATGTAAACTCGAGTTTACATCGTATGTGGTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002839.2-1361s21c1
Sequence:CCGGATTCCGCTCCTGCCAATTTATCTCGAGATAAATTGGCAGGAGCGGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002850    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002839.x-6082s1c1
Sequence:CCGGCTTCCCACCATACTGCTCATACTCGAGTATGAGCAGTATGGTGGGAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002839.x-4297s1c1
Sequence:CCGGCCAAAGAATAGATACGCGAATCTCGAGATTCGCGTATCTATTCTTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002839.x-5143s1c1
Sequence:CCGGGCCAATCTTCCATGTAATAAACTCGAGTTTATTACATGGAAGATTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002839.x-1729s1c1
Sequence:CCGGCCTGAGTCTGAAACAAGTATTCTCGAGAATACTTGTTTCAGACTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002839.x-873s1c1
Sequence:CCGGCCCACCCACTAATCATGAAATCTCGAGATTTCATGATTAGTGGGTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011211
VALIDATED
PTPRD MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase, receptor type, D
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216864    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011211.2-6502s1c1
Sequence:CCGGGTAACCACCAGTCTTACTTATCTCGAGATAAGTAAGACTGGTGGTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216966    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011211.2-7523s1c1
Sequence:CCGGCATAACCAGTACGGTGCTATTCTCGAGAATAGCACCGTACTGGTTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217913    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011211.2-6689s1c1
Sequence:CCGGGAATTTGCCACATGCTATATGCTCGAGCATATAGCATGTGGCAAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011211.2-3827s21c1
Sequence:CCGGCCGGAATGGAGCTCGAATTTACTCGAGTAAATTCGAGCTCCATTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011211.2-1283s21c1
Sequence:CCGGTAAGTCCCTACTCGGATTATGCTCGAGCATAATCCGAGTAGGGACTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011211.2-967s21c1
Sequence:CCGGCCAGAAGATGATATGCCGATACTCGAGTATCGGCATATCATCTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342159    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011211.2-4750s21c1
Sequence:CCGGACCACTTAGTGGGACTATTACCTCGAGGTAATAGTCCCACTAAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011211.2-3088s21c1
Sequence:CCGGCGGGTTCTCTTATCAGCAATACTCGAGTATTGCTGATAAGAGAACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182394    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011211.1-4440s1c1
Sequence:CCGGGCGTTGGAAGAACTGGAGTTTCTCGAGAAACTCCAGTTCTTCCAACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011211.1-967s1c1
Sequence:CCGGCCAGAAGATGATATGCCGATACTCGAGTATCGGCATATCATCTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011211.1-2136s1c1
Sequence:CCGGGAAGTCATATTCCTTTGTGTTCTCGAGAACACAAAGGAATATGACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178212    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011211.1-4004s1c1
Sequence:CCGGGCCAGTTTCCTTGATGGATATCTCGAGATATCCATCAAGGAAACTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011211.1-3088s1c1
Sequence:CCGGCGGGTTCTCTTATCAGCAATACTCGAGTATTGCTGATAAGAGAACCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200197    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011211.1-4238s1c1
Sequence:CCGGCCTCAGTATATCCTGAGGGAACTCGAGTTCCCTCAGGATATACTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197657    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011211.1-334s1c1
Sequence:CCGGCAGAGATTTGAGGTAATAGAACTCGAGTTCTATTACCTCAAATCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011211
VALIDATED
PTPRD MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase, receptor type, D
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216864    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011211.2-6502s1c1
Sequence:CCGGGTAACCACCAGTCTTACTTATCTCGAGATAAGTAAGACTGGTGGTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216966    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011211.2-7523s1c1
Sequence:CCGGCATAACCAGTACGGTGCTATTCTCGAGAATAGCACCGTACTGGTTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217913    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011211.2-6689s1c1
Sequence:CCGGGAATTTGCCACATGCTATATGCTCGAGCATATAGCATGTGGCAAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011211.2-3827s21c1
Sequence:CCGGCCGGAATGGAGCTCGAATTTACTCGAGTAAATTCGAGCTCCATTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011211.2-1283s21c1
Sequence:CCGGTAAGTCCCTACTCGGATTATGCTCGAGCATAATCCGAGTAGGGACTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011211.2-967s21c1
Sequence:CCGGCCAGAAGATGATATGCCGATACTCGAGTATCGGCATATCATCTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342159    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011211.2-4750s21c1
Sequence:CCGGACCACTTAGTGGGACTATTACCTCGAGGTAATAGTCCCACTAAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011211.2-3088s21c1
Sequence:CCGGCGGGTTCTCTTATCAGCAATACTCGAGTATTGCTGATAAGAGAACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182394    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011211.1-4440s1c1
Sequence:CCGGGCGTTGGAAGAACTGGAGTTTCTCGAGAAACTCCAGTTCTTCCAACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011211.1-967s1c1
Sequence:CCGGCCAGAAGATGATATGCCGATACTCGAGTATCGGCATATCATCTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011211.1-2136s1c1
Sequence:CCGGGAAGTCATATTCCTTTGTGTTCTCGAGAACACAAAGGAATATGACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178212    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011211.1-4004s1c1
Sequence:CCGGGCCAGTTTCCTTGATGGATATCTCGAGATATCCATCAAGGAAACTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011211.1-3088s1c1
Sequence:CCGGCGGGTTCTCTTATCAGCAATACTCGAGTATTGCTGATAAGAGAACCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200197    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011211.1-4238s1c1
Sequence:CCGGCCTCAGTATATCCTGAGGGAACTCGAGTTCCCTCAGGATATACTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197657    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011211.1-334s1c1
Sequence:CCGGCAGAGATTTGAGGTAATAGAACTCGAGTTCTATTACCTCAAATCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011211
VALIDATED
PTPRD MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase, receptor type, D
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216864    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011211.2-6502s1c1
Sequence:CCGGGTAACCACCAGTCTTACTTATCTCGAGATAAGTAAGACTGGTGGTTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216966    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011211.2-7523s1c1
Sequence:CCGGCATAACCAGTACGGTGCTATTCTCGAGAATAGCACCGTACTGGTTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217913    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011211.2-6689s1c1
Sequence:CCGGGAATTTGCCACATGCTATATGCTCGAGCATATAGCATGTGGCAAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011211.2-3827s21c1
Sequence:CCGGCCGGAATGGAGCTCGAATTTACTCGAGTAAATTCGAGCTCCATTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011211.2-1283s21c1
Sequence:CCGGTAAGTCCCTACTCGGATTATGCTCGAGCATAATCCGAGTAGGGACTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011211.2-967s21c1
Sequence:CCGGCCAGAAGATGATATGCCGATACTCGAGTATCGGCATATCATCTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342159    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011211.2-4750s21c1
Sequence:CCGGACCACTTAGTGGGACTATTACCTCGAGGTAATAGTCCCACTAAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011211.2-3088s21c1
Sequence:CCGGCGGGTTCTCTTATCAGCAATACTCGAGTATTGCTGATAAGAGAACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182394    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011211.1-4440s1c1
Sequence:CCGGGCGTTGGAAGAACTGGAGTTTCTCGAGAAACTCCAGTTCTTCCAACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011211.1-967s1c1
Sequence:CCGGCCAGAAGATGATATGCCGATACTCGAGTATCGGCATATCATCTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011211.1-2136s1c1
Sequence:CCGGGAAGTCATATTCCTTTGTGTTCTCGAGAACACAAAGGAATATGACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178212    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011211.1-4004s1c1
Sequence:CCGGGCCAGTTTCCTTGATGGATATCTCGAGATATCCATCAAGGAAACTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011211.1-3088s1c1
Sequence:CCGGCGGGTTCTCTTATCAGCAATACTCGAGTATTGCTGATAAGAGAACCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200197    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011211.1-4238s1c1
Sequence:CCGGCCTCAGTATATCCTGAGGGAACTCGAGTTCCCTCAGGATATACTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197657    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011211.1-334s1c1
Sequence:CCGGCAGAGATTTGAGGTAATAGAACTCGAGTTCTATTACCTCAAATCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)