EMAIL THIS PAGE TO A FRIEND

PTPRE

protein tyrosine phosphatase, receptor type, E

239 Gene Product Result for
Synonyms: HPTPE PTPE R-PTP-EPSILON
UniProtKB ID: P23469, Q13345, Q5VWH3, Q5VWH4, Q96KQ6
Gene ID:
Human(5791) Summary: The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. Two alternatively spliced transcript variants of this gene have been reported, one of which encodes a receptor-type PTP that possesses a short extracellular domain, a single transmembrane region, and two tandem intracytoplasmic catalytic domains; Another one encodes a PTP that contains a distinct hydrophilic N-terminus, and thus represents a nonreceptor-type isoform of this PTP. Studies of the similar gene in mice suggested the regulatory roles of this PTP in RAS related signal transduction pathways, cytokines induced SATA signaling, as well as the activation of voltage-gated K+ channels. [provided by RefSeq, Jul 2008]
Mouse(19267) protein tyrosine phosphatase, receptor type, E
Rat(114767) protein tyrosine phosphatase, receptor type, E
chicken(423962) protein tyrosine phosphatase, receptor type, E
dog(609852) protein tyrosine phosphatase, receptor type, E
Horse(100049870) protein tyrosine phosphatase, receptor type, E
domestic cat(101082346) protein tyrosine phosphatase, receptor type, E
domestic guinea pig(100731255) protein tyrosine phosphatase, receptor type, E
naked mole-rat(101716090) protein tyrosine phosphatase, receptor type, E
cow(505285) protein tyrosine phosphatase, receptor type, E
sheep(101117715) protein tyrosine phosphatase, receptor type, E
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006504 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006504 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006504 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011212 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011212 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011212 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006504 siRNAs that have been validated in the lab human pricing
NM_130435 Rosetta Predictions human pricing
NM_053767 Rosetta Predictions rat pricing
NM_011212 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006504 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097498 validated 1935
2 SASI_Hs01_00097499 predicted 849
3 SASI_Hs02_00341712 predicted 1425
4 SASI_Hs01_00097502 predicted 820
5 SASI_Hs01_00097503 predicted 1610
6 SASI_Hs01_00097504 predicted 1394
7 SASI_Hs01_00097505 predicted 1815
8 SASI_Hs01_00097506 predicted 1677
9 SASI_Hs01_00097507 predicted 1658
10 SASI_Hs02_00341713 predicted 1097
11 SASI_Hs01_00097500 predicted 968
12 SASI_Hs01_00097501 predicted 1876
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130435 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074253 predicted 1563
2 SASI_Hs01_00074254 predicted 477
3 SASI_Hs02_00362730 predicted 1052
4 SASI_Hs01_00074257 predicted 450
5 SASI_Hs01_00074258 predicted 1237
6 SASI_Hs01_00074259 predicted 1019
7 SASI_Hs01_00074260 predicted 1442
8 SASI_Hs01_00074261 predicted 1304
9 SASI_Hs01_00074262 predicted 1287
10 SASI_Hs02_00362731 predicted 727
11 SASI_Hs01_00074255 predicted 593
12 SASI_Hs01_00074256 predicted 1507
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053767 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00266553 predicted 582
2 SASI_Rn02_00266554 predicted 1162
3 SASI_Rn02_00266555 predicted 1141
4 SASI_Rn02_00266556 predicted 1644
5 SASI_Rn02_00266557 predicted 441
6 SASI_Rn02_00266558 predicted 1755
7 SASI_Rn02_00266559 predicted 1695
8 SASI_Rn02_00266560 predicted 1385
9 SASI_Rn02_00266561 predicted 1048
10 SASI_Rn02_00266562 predicted 572
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011212 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00121331 predicted 894
2 SASI_Mm01_00121332 predicted 1561
3 SASI_Mm01_00121333 predicted 1961
4 SASI_Mm01_00121334 predicted 1472
5 SASI_Mm01_00121336 predicted 760
6 SASI_Mm02_00320155 predicted 1088
7 SASI_Mm01_00121337 predicted 1364
8 SASI_Mm01_00121338 predicted 1916
9 SASI_Mm01_00121339 predicted 1440
10 SASI_Mm01_00121340 predicted 2145
11 SASI_Mm01_00121335 predicted 1411
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006504
VALIDATED
PTPRE MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase, receptor type, E
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006504.x-529s1c1
Sequence:CCGGCAAGAAGATGCCCAACGGAATCTCGAGATTCCGTTGGGCATCTTCTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_006504.x-712s1c1
Sequence:CCGGTGGACACATACAAGGAACTTTCTCGAGAAAGTTCCTTGTATGTGTCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_006504.x-1433s1c1
Sequence:CCGGACGTTCATCTACCAAGCCTTACTCGAGTAAGGCTTGGTAGATGAACGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_006504.x-1678s1c1
Sequence:CCGGCCGAGTGATCCTTTCCATGAACTCGAGTTCATGGAAAGGATCACTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_006504.x-1746s1c1
Sequence:CCGGGCTACCGACAGAAGGACTATTCTCGAGAATAGTCCTTCTGTCGGTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006504.4-2198s21c1
Sequence:GTACCGGTCATAGCCCTCAGCAACATTTCTCGAGAAATGTTGCTGAGGGCTATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315199    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006504.4-2575s21c1
Sequence:CCGGGGTCAAATAATATCCCATAAACTCGAGTTTATGGGATATTATTTGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_006504.4-959s21c1
Sequence:CCGGCTGCGACCATCGTCATGTTAACTCGAGTTAACATGACGATGGTCGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006504.4-1745s21c1
Sequence:CCGGGCTACCGACAGAAGGACTATTCTCGAGAATAGTCCTTCTGTCGGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006504.4-1677s21c1
Sequence:CCGGCCGAGTGATCCTTTCCATGAACTCGAGTTCATGGAAAGGATCACTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006504.4-1877s21c1
Sequence:CCGGAGGATAAATGCTACCAGTATTCTCGAGAATACTGGTAGCATTTATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006504
VALIDATED
PTPRE MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase, receptor type, E
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006504.x-529s1c1
Sequence:CCGGCAAGAAGATGCCCAACGGAATCTCGAGATTCCGTTGGGCATCTTCTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_006504.x-712s1c1
Sequence:CCGGTGGACACATACAAGGAACTTTCTCGAGAAAGTTCCTTGTATGTGTCCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_006504.x-1433s1c1
Sequence:CCGGACGTTCATCTACCAAGCCTTACTCGAGTAAGGCTTGGTAGATGAACGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_006504.x-1678s1c1
Sequence:CCGGCCGAGTGATCCTTTCCATGAACTCGAGTTCATGGAAAGGATCACTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_006504.x-1746s1c1
Sequence:CCGGGCTACCGACAGAAGGACTATTCTCGAGAATAGTCCTTCTGTCGGTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006504.4-2198s21c1
Sequence:GTACCGGTCATAGCCCTCAGCAACATTTCTCGAGAAATGTTGCTGAGGGCTATGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315199    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006504.4-2575s21c1
Sequence:CCGGGGTCAAATAATATCCCATAAACTCGAGTTTATGGGATATTATTTGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_006504.4-959s21c1
Sequence:CCGGCTGCGACCATCGTCATGTTAACTCGAGTTAACATGACGATGGTCGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006504.4-1745s21c1
Sequence:CCGGGCTACCGACAGAAGGACTATTCTCGAGAATAGTCCTTCTGTCGGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006504.4-1677s21c1
Sequence:CCGGCCGAGTGATCCTTTCCATGAACTCGAGTTCATGGAAAGGATCACTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006504.4-1877s21c1
Sequence:CCGGAGGATAAATGCTACCAGTATTCTCGAGAATACTGGTAGCATTTATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006504
VALIDATED
PTPRE MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase, receptor type, E
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006504.x-529s1c1
Sequence:CCGGCAAGAAGATGCCCAACGGAATCTCGAGATTCCGTTGGGCATCTTCTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_006504.x-712s1c1
Sequence:CCGGTGGACACATACAAGGAACTTTCTCGAGAAAGTTCCTTGTATGTGTCCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_006504.x-1433s1c1
Sequence:CCGGACGTTCATCTACCAAGCCTTACTCGAGTAAGGCTTGGTAGATGAACGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_006504.x-1678s1c1
Sequence:CCGGCCGAGTGATCCTTTCCATGAACTCGAGTTCATGGAAAGGATCACTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_006504.x-1746s1c1
Sequence:CCGGGCTACCGACAGAAGGACTATTCTCGAGAATAGTCCTTCTGTCGGTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006504.4-2198s21c1
Sequence:GTACCGGTCATAGCCCTCAGCAACATTTCTCGAGAAATGTTGCTGAGGGCTATGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315199    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006504.4-2575s21c1
Sequence:CCGGGGTCAAATAATATCCCATAAACTCGAGTTTATGGGATATTATTTGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_006504.4-959s21c1
Sequence:CCGGCTGCGACCATCGTCATGTTAACTCGAGTTAACATGACGATGGTCGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006504.4-1745s21c1
Sequence:CCGGGCTACCGACAGAAGGACTATTCTCGAGAATAGTCCTTCTGTCGGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006504.4-1677s21c1
Sequence:CCGGCCGAGTGATCCTTTCCATGAACTCGAGTTCATGGAAAGGATCACTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006504.4-1877s21c1
Sequence:CCGGAGGATAAATGCTACCAGTATTCTCGAGAATACTGGTAGCATTTATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011212
VALIDATED
PTPRE MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase, receptor type, E
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029939    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011212.2-2524s1c1
Sequence:CCGGCCTTCCTAATTCCTTTGTATACTCGAGTATACAAAGGAATTAGGAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011212.2-1010s1c1
Sequence:CCGGCGTCATGTTGACGAACCTGAACTCGAGTTCAGGTTCGTCAACATGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011212.2-1954s1c1
Sequence:CCGGCGGTGACTCATGGAGATATAACTCGAGTTATATCTCCATGAGTCACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011212.2-725s1c1
Sequence:CCGGCCGAGAGGAGTTCAATTCATTCTCGAGAATGAATTGAACTCCTCTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011212.2-1484s1c1
Sequence:CCGGCCAAGCCTTACTGGAATACTACTCGAGTAGTATTCCAGTAAGGCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011212.3-2239s21c1
Sequence:CCGGTCATAGCACTCAGTAACATTTCTCGAGAAATGTTACTGAGTGCTATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011212.3-1918s21c1
Sequence:CCGGAGGATAAATGCTACCAGTATTCTCGAGAATACTGGTAGCATTTATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011212.3-1959s21c1
Sequence:CCGGACTCATGGAGATATAACTATACTCGAGTATAGTTATATCTCCATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235611    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011212.3-3234s21c1
Sequence:CCGGTGTTATACCAGGCCATCTATTCTCGAGAATAGATGGCCTGGTATAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011212.3-1746s21c1
Sequence:CCGGCAAGAGTTCACAGACTATATCCTCGAGGATATAGTCTGTGAACTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011212
VALIDATED
PTPRE MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase, receptor type, E
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029939    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011212.2-2524s1c1
Sequence:CCGGCCTTCCTAATTCCTTTGTATACTCGAGTATACAAAGGAATTAGGAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011212.2-1010s1c1
Sequence:CCGGCGTCATGTTGACGAACCTGAACTCGAGTTCAGGTTCGTCAACATGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011212.2-1954s1c1
Sequence:CCGGCGGTGACTCATGGAGATATAACTCGAGTTATATCTCCATGAGTCACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011212.2-725s1c1
Sequence:CCGGCCGAGAGGAGTTCAATTCATTCTCGAGAATGAATTGAACTCCTCTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011212.2-1484s1c1
Sequence:CCGGCCAAGCCTTACTGGAATACTACTCGAGTAGTATTCCAGTAAGGCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011212.3-2239s21c1
Sequence:CCGGTCATAGCACTCAGTAACATTTCTCGAGAAATGTTACTGAGTGCTATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011212.3-1918s21c1
Sequence:CCGGAGGATAAATGCTACCAGTATTCTCGAGAATACTGGTAGCATTTATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011212.3-1959s21c1
Sequence:CCGGACTCATGGAGATATAACTATACTCGAGTATAGTTATATCTCCATGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235611    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011212.3-3234s21c1
Sequence:CCGGTGTTATACCAGGCCATCTATTCTCGAGAATAGATGGCCTGGTATAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011212.3-1746s21c1
Sequence:CCGGCAAGAGTTCACAGACTATATCCTCGAGGATATAGTCTGTGAACTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011212
VALIDATED
PTPRE MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase, receptor type, E
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029939    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011212.2-2524s1c1
Sequence:CCGGCCTTCCTAATTCCTTTGTATACTCGAGTATACAAAGGAATTAGGAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011212.2-1010s1c1
Sequence:CCGGCGTCATGTTGACGAACCTGAACTCGAGTTCAGGTTCGTCAACATGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011212.2-1954s1c1
Sequence:CCGGCGGTGACTCATGGAGATATAACTCGAGTTATATCTCCATGAGTCACCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011212.2-725s1c1
Sequence:CCGGCCGAGAGGAGTTCAATTCATTCTCGAGAATGAATTGAACTCCTCTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011212.2-1484s1c1
Sequence:CCGGCCAAGCCTTACTGGAATACTACTCGAGTAGTATTCCAGTAAGGCTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011212.3-2239s21c1
Sequence:CCGGTCATAGCACTCAGTAACATTTCTCGAGAAATGTTACTGAGTGCTATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011212.3-1918s21c1
Sequence:CCGGAGGATAAATGCTACCAGTATTCTCGAGAATACTGGTAGCATTTATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011212.3-1959s21c1
Sequence:CCGGACTCATGGAGATATAACTATACTCGAGTATAGTTATATCTCCATGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235611    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011212.3-3234s21c1
Sequence:CCGGTGTTATACCAGGCCATCTATTCTCGAGAATAGATGGCCTGGTATAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011212.3-1746s21c1
Sequence:CCGGCAAGAGTTCACAGACTATATCCTCGAGGATATAGTCTGTGAACTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)