EMAIL THIS PAGE TO A FRIEND

PTPRG

protein tyrosine phosphatase, receptor type, G

243 Gene Product Result for
Synonyms: HPTPG PTPG R-PTP-GAMMA RPTPG
UniProtKB ID: P23470, B2RU12, Q15623, Q59EE0, Q68DU5
Gene ID:
Human(5793) Summary: The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region of this PTP contains a carbonic anhydrase-like (CAH) domain, which is also found in the extracellular region of PTPRBETA/ZETA. This gene is located in a chromosomal region that is frequently deleted in renal cell carcinoma and lung carcinoma, thus is thought to be a candidate tumor suppressor gene. [provided by RefSeq, Jul 2008]
Mouse(19270) protein tyrosine phosphatase, receptor type, G
Rat(171357) protein tyrosine phosphatase, receptor type, G
chicken(374208) protein tyrosine phosphatase, receptor type, G
dog(484706) protein tyrosine phosphatase, receptor type, G
domestic cat(101085869) protein tyrosine phosphatase, receptor type, G
Horse(100056592) protein tyrosine phosphatase, receptor type, G
domestic guinea pig(100736087) protein tyrosine phosphatase, receptor type, G
naked mole-rat(101724406) protein tyrosine phosphatase, receptor type, G
Domestic Rabbit(100357837) protein tyrosine phosphatase, receptor type, G
cow(540575) protein tyrosine phosphatase, receptor type, G
sheep(101107640) protein tyrosine phosphatase, receptor type, G
Gene Class: Dehydratase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002841 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002841 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002841 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008981 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008981 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008981 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002841 Rosetta Predictions human pricing
NM_134356 Rosetta Predictions rat pricing
NM_008981 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002841 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010591 predicted 3796
2 SASI_Hs01_00010592 predicted 4400
3 SASI_Hs01_00010593 predicted 3989
4 SASI_Hs01_00010594 predicted 1339
5 SASI_Hs02_00334572 predicted 1202
6 SASI_Hs01_00010595 predicted 1373
7 SASI_Hs01_00010596 predicted 2983
8 SASI_Hs02_00334573 predicted 4581
9 SASI_Hs01_00010599 predicted 3145
10 SASI_Hs01_00010600 predicted 713
11 SASI_Hs01_00010597 predicted 4426
12 SASI_Hs01_00010598 predicted 1455
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134356 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00066569 predicted 4244
2 SASI_Rn01_00066570 predicted 2956
3 SASI_Rn01_00066571 predicted 408
4 SASI_Rn01_00066572 predicted 2680
5 SASI_Rn01_00066573 predicted 734
6 SASI_Rn01_00066574 predicted 3598
7 SASI_Rn02_00267911 predicted 4230
8 SASI_Rn01_00066575 predicted 3711
9 SASI_Rn01_00066576 predicted 2259
10 SASI_Rn01_00066577 predicted 3369
11 SASI_Rn01_00066568 predicted 653
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008981 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00315071 predicted 4874
2 SASI_Mm02_00315072 predicted 1315
3 SASI_Mm01_00109955 predicted 4162
4 SASI_Mm01_00109956 predicted 4458
5 SASI_Mm02_00315073 predicted 4862
6 SASI_Mm01_00109957 predicted 3121
7 SASI_Mm01_00109958 predicted 4096
8 SASI_Mm01_00109959 predicted 692
9 SASI_Mm01_00109960 predicted 1803
10 SASI_Mm01_00109961 predicted 3974
11 SASI_Mm01_00109952 predicted 3609
12 SASI_Mm01_00109953 predicted 4203
13 SASI_Mm01_00109954 predicted 3588
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002841
VALIDATED
PTPRG MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase, receptor type, G
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000002860    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002841.x-5496s1c1
Sequence:CCGGTAGGCACTGTTCAATACTGTACTCGAGTACAGTATTGAACAGTGCCTATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002841.3-2045s21c1
Sequence:CCGGAGCTAATACCACTCGAATATTCTCGAGAATATTCGAGTGGTATTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002841.x-1258s1c1
Sequence:CCGGCCAGATGACTTTGACAGCTTTCTCGAGAAAGCTGTCAAAGTCATCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002841.x-4398s1c1
Sequence:CCGGGCCACATACTACGAAAGATTTCTCGAGAAATCTTTCGTAGTATGTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002841.x-1698s1c1
Sequence:CCGGCCACGACATGACAGACTTCTTCTCGAGAAGAAGTCTGTCATGTCGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002841.x-2168s1c1
Sequence:CCGGGCATCCCATTCTCATTTGTTTCTCGAGAAACAAATGAGAATGGGATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002841.3-2005s21c1
Sequence:CCGGACGACATGCGCAGCGACTTTACTCGAGTAAAGTCGCTGCGCATGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355985    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002841.3-5268s21c1
Sequence:CCGGTTACCTAGTTTGCACTATATGCTCGAGCATATAGTGCAAACTAGGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002841
VALIDATED
PTPRG MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase, receptor type, G
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000002860    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002841.x-5496s1c1
Sequence:CCGGTAGGCACTGTTCAATACTGTACTCGAGTACAGTATTGAACAGTGCCTATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002841.3-2045s21c1
Sequence:CCGGAGCTAATACCACTCGAATATTCTCGAGAATATTCGAGTGGTATTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002841.x-1258s1c1
Sequence:CCGGCCAGATGACTTTGACAGCTTTCTCGAGAAAGCTGTCAAAGTCATCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002841.x-4398s1c1
Sequence:CCGGGCCACATACTACGAAAGATTTCTCGAGAAATCTTTCGTAGTATGTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002841.x-1698s1c1
Sequence:CCGGCCACGACATGACAGACTTCTTCTCGAGAAGAAGTCTGTCATGTCGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002841.x-2168s1c1
Sequence:CCGGGCATCCCATTCTCATTTGTTTCTCGAGAAACAAATGAGAATGGGATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002841.3-2005s21c1
Sequence:CCGGACGACATGCGCAGCGACTTTACTCGAGTAAAGTCGCTGCGCATGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355985    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002841.3-5268s21c1
Sequence:CCGGTTACCTAGTTTGCACTATATGCTCGAGCATATAGTGCAAACTAGGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002841
VALIDATED
PTPRG MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase, receptor type, G
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000002860    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002841.x-5496s1c1
Sequence:CCGGTAGGCACTGTTCAATACTGTACTCGAGTACAGTATTGAACAGTGCCTATTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002841.3-2045s21c1
Sequence:CCGGAGCTAATACCACTCGAATATTCTCGAGAATATTCGAGTGGTATTAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002841.x-1258s1c1
Sequence:CCGGCCAGATGACTTTGACAGCTTTCTCGAGAAAGCTGTCAAAGTCATCTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002841.x-4398s1c1
Sequence:CCGGGCCACATACTACGAAAGATTTCTCGAGAAATCTTTCGTAGTATGTGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002841.x-1698s1c1
Sequence:CCGGCCACGACATGACAGACTTCTTCTCGAGAAGAAGTCTGTCATGTCGTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002841.x-2168s1c1
Sequence:CCGGGCATCCCATTCTCATTTGTTTCTCGAGAAACAAATGAGAATGGGATGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002841.3-2005s21c1
Sequence:CCGGACGACATGCGCAGCGACTTTACTCGAGTAAAGTCGCTGCGCATGTCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355985    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002841.3-5268s21c1
Sequence:CCGGTTACCTAGTTTGCACTATATGCTCGAGCATATAGTGCAAACTAGGTAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008981
VALIDATED
PTPRG MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase, receptor type, G
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000314474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008981.3-3659s21c1
Sequence:CCGGCCGTCGTCTTTCAGTTAGAAACTCGAGTTTCTAACTGAAAGACGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008981.3-1614s21c1
Sequence:CCGGCGACCACAACAAGCTCTGAATCTCGAGATTCAGAGCTTGTTGTGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008981.1-2712s1c1
Sequence:CCGGCCTGTCAAACAGTTTGGTAAACTCGAGTTTACCAAACTGTTTGACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008981.1-3820s1c1
Sequence:CCGGCCGGGATGAAAGGAACAGATTCTCGAGAATCTGTTCCTTTCATCCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008981.1-1155s1c1
Sequence:CCGGCGACCACAACAAGCTCTGAATCTCGAGATTCAGAGCTTGTTGTGGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008981.1-4084s1c1
Sequence:CCGGGCCTCTCGAATGAAGAACAAACTCGAGTTTGTTCTTCATTCGAGAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008981.1-3200s1c1
Sequence:CCGGCCGTCGTCTTTCAGTTAGAAACTCGAGTTTCTAACTGAAAGACGACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008981.3-4543s21c1
Sequence:CCGGGCCTCTCGAATGAAGAACAAACTCGAGTTTGTTCTTCATTCGAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008981.3-4279s21c1
Sequence:CCGGCCGGGATGAAAGGAACAGATTCTCGAGAATCTGTTCCTTTCATCCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008981
VALIDATED
PTPRG MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase, receptor type, G
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000314474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008981.3-3659s21c1
Sequence:CCGGCCGTCGTCTTTCAGTTAGAAACTCGAGTTTCTAACTGAAAGACGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008981.3-1614s21c1
Sequence:CCGGCGACCACAACAAGCTCTGAATCTCGAGATTCAGAGCTTGTTGTGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008981.1-2712s1c1
Sequence:CCGGCCTGTCAAACAGTTTGGTAAACTCGAGTTTACCAAACTGTTTGACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008981.1-3820s1c1
Sequence:CCGGCCGGGATGAAAGGAACAGATTCTCGAGAATCTGTTCCTTTCATCCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008981.1-1155s1c1
Sequence:CCGGCGACCACAACAAGCTCTGAATCTCGAGATTCAGAGCTTGTTGTGGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008981.1-4084s1c1
Sequence:CCGGGCCTCTCGAATGAAGAACAAACTCGAGTTTGTTCTTCATTCGAGAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008981.1-3200s1c1
Sequence:CCGGCCGTCGTCTTTCAGTTAGAAACTCGAGTTTCTAACTGAAAGACGACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008981.3-4543s21c1
Sequence:CCGGGCCTCTCGAATGAAGAACAAACTCGAGTTTGTTCTTCATTCGAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008981.3-4279s21c1
Sequence:CCGGCCGGGATGAAAGGAACAGATTCTCGAGAATCTGTTCCTTTCATCCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008981
VALIDATED
PTPRG MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase, receptor type, G
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000314474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008981.3-3659s21c1
Sequence:CCGGCCGTCGTCTTTCAGTTAGAAACTCGAGTTTCTAACTGAAAGACGACGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008981.3-1614s21c1
Sequence:CCGGCGACCACAACAAGCTCTGAATCTCGAGATTCAGAGCTTGTTGTGGTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008981.1-2712s1c1
Sequence:CCGGCCTGTCAAACAGTTTGGTAAACTCGAGTTTACCAAACTGTTTGACAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008981.1-3820s1c1
Sequence:CCGGCCGGGATGAAAGGAACAGATTCTCGAGAATCTGTTCCTTTCATCCCGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008981.1-1155s1c1
Sequence:CCGGCGACCACAACAAGCTCTGAATCTCGAGATTCAGAGCTTGTTGTGGTCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008981.1-4084s1c1
Sequence:CCGGGCCTCTCGAATGAAGAACAAACTCGAGTTTGTTCTTCATTCGAGAGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008981.1-3200s1c1
Sequence:CCGGCCGTCGTCTTTCAGTTAGAAACTCGAGTTTCTAACTGAAAGACGACGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008981.3-4543s21c1
Sequence:CCGGGCCTCTCGAATGAAGAACAAACTCGAGTTTGTTCTTCATTCGAGAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008981.3-4279s21c1
Sequence:CCGGCCGGGATGAAAGGAACAGATTCTCGAGAATCTGTTCCTTTCATCCCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)