EMAIL THIS PAGE TO A FRIEND

PTPRH

protein tyrosine phosphatase, receptor type, H

80 Gene Product Result for
Synonyms: SAP1
UniProtKB ID: Q9HD43, Q15426, Q2NKN9, Q2NKP0
Gene ID:
Human(5794) Summary: The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and a single intracytoplasmic catalytic domain, and thus represents a receptor-type PTP. The extracellular region contains eight fibronectin type III-like repeats and multiple N-glycosylation sites. The gene was shown to be expressed primarily in brain and liver, and at a lower level in heart and stomach. It was also found to be expressed in several cancer cell lines, but not in the corresponding normal tissues. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2009]
Mouse(545902) protein tyrosine phosphatase, receptor type, H
Rat(171125) protein tyrosine phosphatase, receptor type, H
Zebrafish(569071) protein tyrosine phosphatase, receptor type, h
domestic cat(101092313) protein tyrosine phosphatase, receptor type, H
Horse(100055444) protein tyrosine phosphatase, receptor type, H
dog(484299) protein tyrosine phosphatase, receptor type, H
cow(521868) protein tyrosine phosphatase, receptor type, H
sheep(101122050) protein tyrosine phosphatase, receptor type, H
naked mole-rat(101710915) protein tyrosine phosphatase, receptor type, H
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002842 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002842 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002842 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_207270 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_207270 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_207270 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002842 Rosetta Predictions human pricing
XM_001071263 Rosetta Predictions rat pricing
XM_574357 Rosetta Predictions rat pricing
NM_207270 Rosetta Predictions mouse pricing
XM_620401 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002842 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068177 predicted 1699
2 SASI_Hs01_00068178 predicted 2591
3 SASI_Hs02_00334574 predicted 3238
4 SASI_Hs01_00068179 predicted 850
5 SASI_Hs01_00068181 predicted 1751
6 SASI_Hs01_00068182 predicted 335
7 SASI_Hs01_00068183 predicted 1949
8 SASI_Hs01_00068184 predicted 312
9 SASI_Hs01_00068180 predicted 227
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071263 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00334397 predicted 1791
2 SASI_Rn02_00334398 predicted 1787
3 SASI_Rn02_00334399 predicted 2108
4 SASI_Rn02_00334400 predicted 1454
5 SASI_Rn02_00334401 predicted 1425
6 SASI_Rn02_00334402 predicted 1112
7 SASI_Rn02_00334403 predicted 1447
8 SASI_Rn02_00334404 predicted 667
9 SASI_Rn02_00334405 predicted 1755
10 SASI_Rn02_00334406 predicted 311
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574357 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00401841 predicted 3209
2 SASI_Rn02_00401842 predicted 2569
3 SASI_Rn02_00401843 predicted 2898
4 SASI_Rn02_00401844 predicted 2530
5 SASI_Rn02_00401845 predicted 2769
6 SASI_Rn02_00401846 predicted 2786
7 SASI_Rn02_00401847 predicted 3042
8 SASI_Rn02_00401848 predicted 2618
9 SASI_Rn02_00401849 predicted 2854
10 SASI_Rn02_00401850 predicted 2762
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207270 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00352016 predicted 2178
2 SASI_Mm02_00352017 predicted 408
3 SASI_Mm02_00352018 predicted 1257
4 SASI_Mm02_00352019 predicted 2465
5 SASI_Mm02_00352020 predicted 2656
6 SASI_Mm02_00352021 predicted 3214
7 SASI_Mm02_00352022 predicted 1325
8 SASI_Mm02_00352023 predicted 689
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_620401 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00272662 predicted 2701
2 SASI_Mm01_00272663 predicted 2345
3 SASI_Mm01_00272664 predicted 2996
4 SASI_Mm01_00272665 predicted 3184
5 SASI_Mm01_00272666 predicted 1327
6 SASI_Mm01_00272667 predicted 1227
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002842
PTPRH MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase, receptor type, H
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000355631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002842.3-3265s21c1
Sequence:CCGGGACTGAGGCTCAGTACGTATTCTCGAGAATACGTACTGAGCCTCAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002842.3-1846s21c1
Sequence:CCGGCCACTCTCAGTTGTACGTATACTCGAGTATACGTACAACTGAGAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002842.3-1947s21c1
Sequence:CCGGCCAATGAGACGTGGTACAAAGCTCGAGCTTTGTACCACGTCTCATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002842.3-1136s21c1
Sequence:CCGGAGACTTGAACCCGGGTGTTTGCTCGAGCAAACACCCGGGTTCAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002842.3-373s21c1
Sequence:CCGGGGTGGAGAAAGACGGAGTAAACTCGAGTTTACTCCGTCTTTCTCCACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002842.x-907s1c1
Sequence:CCGGCGTGGAGATTGGTAACTAGTACTCGAGTACTAGTTACCAATCTCCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002842.x-1338s1c1
Sequence:CCGGGAGACCCGAAACACAACAAATCTCGAGATTTGTTGTGTTTCGGGTCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002842.x-253s1c1
Sequence:CCGGGCGGCACAACAGAGACTCGAACTCGAGTTCGAGTCTCTGTTGTGCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002866    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002842.x-3621s1c1
Sequence:CCGGAGAGGGATGATAGCTTGGATTCTCGAGAATCCAAGCTATCATCCCTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002842
PTPRH MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase, receptor type, H
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000355631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002842.3-3265s21c1
Sequence:CCGGGACTGAGGCTCAGTACGTATTCTCGAGAATACGTACTGAGCCTCAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002842.3-1846s21c1
Sequence:CCGGCCACTCTCAGTTGTACGTATACTCGAGTATACGTACAACTGAGAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002842.3-1947s21c1
Sequence:CCGGCCAATGAGACGTGGTACAAAGCTCGAGCTTTGTACCACGTCTCATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002842.3-1136s21c1
Sequence:CCGGAGACTTGAACCCGGGTGTTTGCTCGAGCAAACACCCGGGTTCAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002842.3-373s21c1
Sequence:CCGGGGTGGAGAAAGACGGAGTAAACTCGAGTTTACTCCGTCTTTCTCCACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002842.x-907s1c1
Sequence:CCGGCGTGGAGATTGGTAACTAGTACTCGAGTACTAGTTACCAATCTCCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002842.x-1338s1c1
Sequence:CCGGGAGACCCGAAACACAACAAATCTCGAGATTTGTTGTGTTTCGGGTCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002842.x-253s1c1
Sequence:CCGGGCGGCACAACAGAGACTCGAACTCGAGTTCGAGTCTCTGTTGTGCCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002866    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002842.x-3621s1c1
Sequence:CCGGAGAGGGATGATAGCTTGGATTCTCGAGAATCCAAGCTATCATCCCTCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002842
PTPRH MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase, receptor type, H
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000355631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002842.3-3265s21c1
Sequence:CCGGGACTGAGGCTCAGTACGTATTCTCGAGAATACGTACTGAGCCTCAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002842.3-1846s21c1
Sequence:CCGGCCACTCTCAGTTGTACGTATACTCGAGTATACGTACAACTGAGAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002842.3-1947s21c1
Sequence:CCGGCCAATGAGACGTGGTACAAAGCTCGAGCTTTGTACCACGTCTCATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002842.3-1136s21c1
Sequence:CCGGAGACTTGAACCCGGGTGTTTGCTCGAGCAAACACCCGGGTTCAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002842.3-373s21c1
Sequence:CCGGGGTGGAGAAAGACGGAGTAAACTCGAGTTTACTCCGTCTTTCTCCACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002842.x-907s1c1
Sequence:CCGGCGTGGAGATTGGTAACTAGTACTCGAGTACTAGTTACCAATCTCCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002842.x-1338s1c1
Sequence:CCGGGAGACCCGAAACACAACAAATCTCGAGATTTGTTGTGTTTCGGGTCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002842.x-253s1c1
Sequence:CCGGGCGGCACAACAGAGACTCGAACTCGAGTTCGAGTCTCTGTTGTGCCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002866    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002842.x-3621s1c1
Sequence:CCGGAGAGGGATGATAGCTTGGATTCTCGAGAATCCAAGCTATCATCCCTCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207270
PTPRH MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase, receptor type, H
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207270.1-2098s1c1
Sequence:CCGGGCCAGTCTCAAATAACGGCATCTCGAGATGCCGTTATTTGAGACTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207270.1-2483s1c1
Sequence:CCGGGCATCTTCAACTCTTCCATATCTCGAGATATGGAAGAGTTGAAGATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207270.1-2892s1c1
Sequence:CCGGGCAAGCTTAGTTTATGAGAATCTCGAGATTCTCATAAACTAAGCTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207270.1-2004s1c1
Sequence:CCGGGCCAAAGACTTTGCTGACCATCTCGAGATGGTCAGCAAAGTCTTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207270.1-1218s1c1
Sequence:CCGGGATGGACTTGATCCTGGGTTTCTCGAGAAACCCAGGATCAAGTCCATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207270
PTPRH MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase, receptor type, H
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207270.1-2098s1c1
Sequence:CCGGGCCAGTCTCAAATAACGGCATCTCGAGATGCCGTTATTTGAGACTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207270.1-2483s1c1
Sequence:CCGGGCATCTTCAACTCTTCCATATCTCGAGATATGGAAGAGTTGAAGATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207270.1-2892s1c1
Sequence:CCGGGCAAGCTTAGTTTATGAGAATCTCGAGATTCTCATAAACTAAGCTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207270.1-2004s1c1
Sequence:CCGGGCCAAAGACTTTGCTGACCATCTCGAGATGGTCAGCAAAGTCTTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207270.1-1218s1c1
Sequence:CCGGGATGGACTTGATCCTGGGTTTCTCGAGAAACCCAGGATCAAGTCCATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207270
PTPRH MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase, receptor type, H
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207270.1-2098s1c1
Sequence:CCGGGCCAGTCTCAAATAACGGCATCTCGAGATGCCGTTATTTGAGACTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207270.1-2483s1c1
Sequence:CCGGGCATCTTCAACTCTTCCATATCTCGAGATATGGAAGAGTTGAAGATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207270.1-2892s1c1
Sequence:CCGGGCAAGCTTAGTTTATGAGAATCTCGAGATTCTCATAAACTAAGCTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207270.1-2004s1c1
Sequence:CCGGGCCAAAGACTTTGCTGACCATCTCGAGATGGTCAGCAAAGTCTTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207270.1-1218s1c1
Sequence:CCGGGATGGACTTGATCCTGGGTTTCTCGAGAAACCCAGGATCAAGTCCATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)