EMAIL THIS PAGE TO A FRIEND

PTPRK

protein tyrosine phosphatase, receptor type, K

170 Gene Product Result for
Synonyms: R-PTP-kappa
UniProtKB ID: Q15262, B2RTQ8, Q14763, Q5TG10, Q5TG11
Gene ID:
Human(5796) Summary: The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP mu (MAM) domain, an Ig-like domain and four fibronectin type III-like repeats. This PTP was shown to mediate homophilic intercellular interaction, possibly through the interaction with beta- and gamma-catenin at adherens junctions. Expression of this gene was found to be stimulated by TGF-beta 1, which may be important for the inhibition of keratinocyte proliferation. [provided by RefSeq, Jul 2008]
Mouse(19272) protein tyrosine phosphatase, receptor type, K
Rat(360302) protein tyrosine phosphatase, receptor type, K
Zebrafish(555348) protein tyrosine phosphatase, receptor type, K
Horse(100073063) protein tyrosine phosphatase, receptor type, K
domestic cat(101092366) protein tyrosine phosphatase, receptor type, K
dog(476290) protein tyrosine phosphatase, receptor type, K
chicken(421711) protein tyrosine phosphatase, receptor type, K
cow(509657) protein tyrosine phosphatase, receptor type, K
sheep(101116916) protein tyrosine phosphatase, receptor type, K
Domestic Rabbit(100339990) protein tyrosine phosphatase, receptor type, K
naked mole-rat(101723444) protein tyrosine phosphatase, receptor type, K
domestic guinea pig(100730543) protein tyrosine phosphatase, receptor type, K
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002844 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002844 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002844 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008983 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008983 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008983 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU004011 MISSION® esiRNA targeting human PTPRK human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002844 siRNAs that have been validated in the lab human pricing
NM_001029902 Rosetta Predictions rat pricing
NM_008983 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002844 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047197 validated 4146
1 SASI_Hs01_00047195 validated 4329
2 SASI_Hs02_00334581 predicted 3016
3 SASI_Hs01_00047198 predicted 349
4 SASI_Hs01_00047199 predicted 1245
5 SASI_Hs01_00047200 predicted 2961
6 SASI_Hs01_00047201 predicted 1977
7 SASI_Hs01_00047202 predicted 4115
8 SASI_Hs01_00047203 predicted 3049
9 SASI_Hs01_00047204 predicted 3407
10 SASI_Hs01_00047196 predicted 1617
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029902 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00203465 predicted 2704
2 SASI_Rn01_00105665 predicted 542
3 SASI_Rn01_00105667 predicted 859
4 SASI_Rn02_00203466 predicted 3006
5 SASI_Rn02_00203467 predicted 2584
6 SASI_Rn01_00105670 predicted 1117
7 SASI_Rn02_00203468 predicted 3770
8 SASI_Rn02_00203469 predicted 3171
9 SASI_Rn02_00203470 predicted 628
10 SASI_Rn02_00203471 predicted 4184
11 SASI_Rn01_00105663 predicted 2419
12 SASI_Rn01_00105664 predicted 1836
13 SASI_Rn01_00105666 predicted 813
14 SASI_Rn01_00105668 predicted 647
15 SASI_Rn01_00105669 predicted 2027
16 SASI_Rn01_00105671 predicted 2477
17 SASI_Rn01_00105672 predicted 1581
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008983 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00085084 predicted 2258
2 SASI_Mm01_00085085 predicted 1179
3 SASI_Mm02_00315075 predicted 1393
4 SASI_Mm01_00085086 predicted 815
5 SASI_Mm02_00315076 predicted 1696
6 SASI_Mm02_00315077 predicted 3191
7 SASI_Mm01_00085087 predicted 4592
8 SASI_Mm01_00085088 predicted 650
9 SASI_Mm01_00085089 predicted 3252
10 SASI_Mm01_00085092 predicted 4004
11 SASI_Mm01_00085090 predicted 5086
12 SASI_Mm01_00085091 predicted 4640
13 SASI_Mm01_00085093 predicted 3778
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002844
VALIDATED
PTPRK MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase, receptor type, K
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002844.3-1374s21c1
Sequence:CCGGTAGATCCAGATACCGAATATGCTCGAGCATATTCGGTATCTGGATCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002844.3-798s21c1
Sequence:CCGGCCAATGAATATCAGGTAATATCTCGAGATATTACCTGATATTCATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_002844.x-941s1c1
Sequence:CCGGGCCCAGACTAAGAACATCAATCTCGAGATTGATGTTCTTAGTCTGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002844.3-3667s21c1
Sequence:CCGGCTTAAGATCTCGGCGTATTAACTCGAGTTAATACGCCGAGATCTTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002844.x-3415s1c1
Sequence:CCGGCCGGCGAGTCAAGTTATCAAACTCGAGTTTGATAACTTGACTCGCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002876    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002844.x-4884s1c1
Sequence:CCGGCATACTTTCTACGTGGCATTTCTCGAGAAATGCCACGTAGAAAGTATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002844.3-3291s21c1
Sequence:CCGGGCCGGGTTAAATGCTATAAATCTCGAGATTTATAGCATTTAACCCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002844.3-1677s21c1
Sequence:CCGGTGAACCATCTGCCACCTTATACTCGAGTATAAGGTGGCAGATGGTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002844.x-3947s1c1
Sequence:CCGGGCTGCTTTCATCGTCACACAACTCGAGTTGTGTGACGATGAAAGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002844.x-1997s1c1
Sequence:CCGGGCTCCAACTTTACCTGACTATCTCGAGATAGTCAGGTAAAGTTGGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002844
VALIDATED
PTPRK MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase, receptor type, K
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002844.3-1374s21c1
Sequence:CCGGTAGATCCAGATACCGAATATGCTCGAGCATATTCGGTATCTGGATCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002844.3-798s21c1
Sequence:CCGGCCAATGAATATCAGGTAATATCTCGAGATATTACCTGATATTCATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_002844.x-941s1c1
Sequence:CCGGGCCCAGACTAAGAACATCAATCTCGAGATTGATGTTCTTAGTCTGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002844.3-3667s21c1
Sequence:CCGGCTTAAGATCTCGGCGTATTAACTCGAGTTAATACGCCGAGATCTTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002844.x-3415s1c1
Sequence:CCGGCCGGCGAGTCAAGTTATCAAACTCGAGTTTGATAACTTGACTCGCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002876    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002844.x-4884s1c1
Sequence:CCGGCATACTTTCTACGTGGCATTTCTCGAGAAATGCCACGTAGAAAGTATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002844.3-3291s21c1
Sequence:CCGGGCCGGGTTAAATGCTATAAATCTCGAGATTTATAGCATTTAACCCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002844.3-1677s21c1
Sequence:CCGGTGAACCATCTGCCACCTTATACTCGAGTATAAGGTGGCAGATGGTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002844.x-3947s1c1
Sequence:CCGGGCTGCTTTCATCGTCACACAACTCGAGTTGTGTGACGATGAAAGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002844.x-1997s1c1
Sequence:CCGGGCTCCAACTTTACCTGACTATCTCGAGATAGTCAGGTAAAGTTGGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002844
VALIDATED
PTPRK MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase, receptor type, K
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002844.3-1374s21c1
Sequence:CCGGTAGATCCAGATACCGAATATGCTCGAGCATATTCGGTATCTGGATCTATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000356038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002844.3-798s21c1
Sequence:CCGGCCAATGAATATCAGGTAATATCTCGAGATATTACCTGATATTCATTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000002874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_002844.x-941s1c1
Sequence:CCGGGCCCAGACTAAGAACATCAATCTCGAGATTGATGTTCTTAGTCTGGGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000427727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002844.3-3667s21c1
Sequence:CCGGCTTAAGATCTCGGCGTATTAACTCGAGTTAATACGCCGAGATCTTAAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000002875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002844.x-3415s1c1
Sequence:CCGGCCGGCGAGTCAAGTTATCAAACTCGAGTTTGATAACTTGACTCGCCGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000002876    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002844.x-4884s1c1
Sequence:CCGGCATACTTTCTACGTGGCATTTCTCGAGAAATGCCACGTAGAAAGTATGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000378570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002844.3-3291s21c1
Sequence:CCGGGCCGGGTTAAATGCTATAAATCTCGAGATTTATAGCATTTAACCCGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000420364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002844.3-1677s21c1
Sequence:CCGGTGAACCATCTGCCACCTTATACTCGAGTATAAGGTGGCAGATGGTTCATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000002873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002844.x-3947s1c1
Sequence:CCGGGCTGCTTTCATCGTCACACAACTCGAGTTGTGTGACGATGAAAGCAGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000002877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002844.x-1997s1c1
Sequence:CCGGGCTCCAACTTTACCTGACTATCTCGAGATAGTCAGGTAAAGTTGGAGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008983
VALIDATED
PTPRK MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase, receptor type, K
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000336469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008983.2-4706s21c1
Sequence:CCGGTGTTACTGCACCGAGAGATTTCTCGAGAAATCTCTCGGTGCAGTAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008983.2-979s21c1
Sequence:CCGGGCCCAGACTAAGAACATAAATCTCGAGATTTATGTTCTTAGTCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008983.2-1177s21c1
Sequence:CCGGTACTTGCTGATCCAACTAAATCTCGAGATTTAGTTGGATCAGCAAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008983.1-4160s1c1
Sequence:CCGGGCCGGGTGAAATGCTATAAATCTCGAGATTTATAGCATTTCACCCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008983.1-3130s1c1
Sequence:CCGGCCCTATTACTTTGCCGCAGAACTCGAGTTCTGCGGCAAAGTAATAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008983.1-1275s1c1
Sequence:CCGGCCAGGATTTATACGATGACTTCTCGAGAAGTCATCGTATAAATCCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008983.1-1852s1c1
Sequence:CCGGGCCCAGACTAAGAACATAAATCTCGAGATTTATGTTCTTAGTCTGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008983.1-2403s1c1
Sequence:CCGGCGTCACTATCTGCTACCATTACTCGAGTAATGGTAGCAGATAGTGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008983.2-740s21c1
Sequence:CCGGCCAATGAATACCAGGTAATATCTCGAGATATTACCTGGTATTCATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008983.2-3664s21c1
Sequence:CCGGTTACGATCTCGGCGCATTAATCTCGAGATTAATGCGCCGAGATCGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008983
VALIDATED
PTPRK MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase, receptor type, K
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000336469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008983.2-4706s21c1
Sequence:CCGGTGTTACTGCACCGAGAGATTTCTCGAGAAATCTCTCGGTGCAGTAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008983.2-979s21c1
Sequence:CCGGGCCCAGACTAAGAACATAAATCTCGAGATTTATGTTCTTAGTCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008983.2-1177s21c1
Sequence:CCGGTACTTGCTGATCCAACTAAATCTCGAGATTTAGTTGGATCAGCAAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008983.1-4160s1c1
Sequence:CCGGGCCGGGTGAAATGCTATAAATCTCGAGATTTATAGCATTTCACCCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008983.1-3130s1c1
Sequence:CCGGCCCTATTACTTTGCCGCAGAACTCGAGTTCTGCGGCAAAGTAATAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008983.1-1275s1c1
Sequence:CCGGCCAGGATTTATACGATGACTTCTCGAGAAGTCATCGTATAAATCCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008983.1-1852s1c1
Sequence:CCGGGCCCAGACTAAGAACATAAATCTCGAGATTTATGTTCTTAGTCTGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008983.1-2403s1c1
Sequence:CCGGCGTCACTATCTGCTACCATTACTCGAGTAATGGTAGCAGATAGTGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008983.2-740s21c1
Sequence:CCGGCCAATGAATACCAGGTAATATCTCGAGATATTACCTGGTATTCATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008983.2-3664s21c1
Sequence:CCGGTTACGATCTCGGCGCATTAATCTCGAGATTAATGCGCCGAGATCGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008983
VALIDATED
PTPRK MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase, receptor type, K
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000336469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008983.2-4706s21c1
Sequence:CCGGTGTTACTGCACCGAGAGATTTCTCGAGAAATCTCTCGGTGCAGTAACATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000336532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008983.2-979s21c1
Sequence:CCGGGCCCAGACTAAGAACATAAATCTCGAGATTTATGTTCTTAGTCTGGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000336468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008983.2-1177s21c1
Sequence:CCGGTACTTGCTGATCCAACTAAATCTCGAGATTTAGTTGGATCAGCAAGTATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000029959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008983.1-4160s1c1
Sequence:CCGGGCCGGGTGAAATGCTATAAATCTCGAGATTTATAGCATTTCACCCGGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000029961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008983.1-3130s1c1
Sequence:CCGGCCCTATTACTTTGCCGCAGAACTCGAGTTCTGCGGCAAAGTAATAGGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000029962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008983.1-1275s1c1
Sequence:CCGGCCAGGATTTATACGATGACTTCTCGAGAAGTCATCGTATAAATCCTGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000029960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008983.1-1852s1c1
Sequence:CCGGGCCCAGACTAAGAACATAAATCTCGAGATTTATGTTCTTAGTCTGGGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000029963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008983.1-2403s1c1
Sequence:CCGGCGTCACTATCTGCTACCATTACTCGAGTAATGGTAGCAGATAGTGACGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000336534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008983.2-740s21c1
Sequence:CCGGCCAATGAATACCAGGTAATATCTCGAGATATTACCTGGTATTCATTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000353475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008983.2-3664s21c1
Sequence:CCGGTTACGATCTCGGCGCATTAATCTCGAGATTAATGCGCCGAGATCGTAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???