EMAIL THIS PAGE TO A FRIEND

PTPRM

protein tyrosine phosphatase, receptor type, M

156 Gene Product Result for
Synonyms: PTPRL1 R-PTP-MU RPTPM RPTPU hR-PTPu
UniProtKB ID: P28827, A7MBN1, D3DUH8, J3QL11
Gene ID:
Human(5797) Summary: The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP mu (MAM) domain, an Ig-like domain and four fibronectin type III-like repeats. This PTP has been shown to mediate cell-cell aggregation through the interaction with another molecule of this PTP on an adjacent cell. This PTP can interact with scaffolding protein RACK1/GNB2L1, which may be necessary for the downstream signaling in response to cell-cell adhesion. Alternative splicing results in multiple transcripts encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Mouse(19274) protein tyrosine phosphatase, receptor type, M
Rat(29616) protein tyrosine phosphatase, receptor type, M
domestic guinea pig(100714550) protein tyrosine phosphatase, receptor type, M
naked mole-rat(101707728) protein tyrosine phosphatase, receptor type, M
Domestic Rabbit(100356969) protein tyrosine phosphatase, receptor type, M
cow(536092) protein tyrosine phosphatase, receptor type, M
sheep(101102951) protein tyrosine phosphatase, receptor type, M
chicken(426242) protein tyrosine phosphatase, receptor type, M
domestic cat(101080832) protein tyrosine phosphatase, receptor type, M
Horse(100059664) protein tyrosine phosphatase, receptor type, M
dog(480203) protein tyrosine phosphatase, receptor type, M
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008984 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008984 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008984 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002845 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002845 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002845 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU013791 MISSION® esiRNA esiRNA targeting human PTPRM (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001105244 Rosetta Predictions human pricing
NM_002845 Rosetta Predictions human pricing
XM_001053209 Rosetta Predictions rat pricing
XM_343640 Rosetta Predictions rat pricing
NM_008984 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105244 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ?
1 SASI_Hs02_00324044 predicted 1492
2 SASI_Hs02_00324045 predicted 3515
3 SASI_Hs02_00324046 predicted 4080
4 SASI_Hs02_00324047 predicted 2282
5 SASI_Hs02_00324048 predicted 1962
6 SASI_Hs02_00324049 predicted 3324
7 SASI_Hs02_00324050 predicted 3966
8 SASI_Hs02_00324051 predicted 1002
9 SASI_Hs02_00324052 predicted 2351
10 SASI_Hs02_00324053 predicted 3758
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002845 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ?
1 SASI_Hs01_00093969 predicted 1494
2 SASI_Hs01_00093970 predicted 3470
3 SASI_Hs01_00093971 predicted 4044
4 SASI_Hs01_00093972 predicted 2280
5 SASI_Hs01_00093973 predicted 1961
6 SASI_Hs01_00093974 predicted 3288
7 SASI_Hs02_00334582 predicted 3928
8 SASI_Hs01_00093975 predicted 996
9 SASI_Hs01_00093976 predicted 2353
10 SASI_Hs02_00334583 predicted 3721
11 SASI_Hs01_00093977 predicted 817
12 SASI_Hs01_00093978 predicted 2864
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053209 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ?
1 SASI_Rn02_00271632 predicted 3889
2 SASI_Rn02_00271633 predicted 1262
3 SASI_Rn02_00271634 predicted 1959
4 SASI_Rn02_00271635 predicted 3280
5 SASI_Rn02_00271636 predicted 2993
6 SASI_Rn02_00271637 predicted 4586
7 SASI_Rn02_00271638 predicted 922
8 SASI_Rn02_00271639 predicted 4533
9 SASI_Rn02_00271640 predicted 2984
10 SASI_Rn02_00271641 predicted 553
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343640 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ?
1 SASI_Rn02_00396138 predicted 3890
2 SASI_Rn02_00396139 predicted 1258
3 SASI_Rn02_00396140 predicted 1962
4 SASI_Rn02_00396141 predicted 3281
5 SASI_Rn02_00396142 predicted 2994
6 SASI_Rn02_00396143 predicted 4583
7 SASI_Rn02_00396144 predicted 922
8 SASI_Rn02_00396145 predicted 4529
9 SASI_Rn02_00396146 predicted 2982
10 SASI_Rn02_00396147 predicted 547
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008984 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ?
1 SASI_Mm01_00031773 predicted 1157
2 SASI_Mm01_00031774 predicted 3570
3 SASI_Mm01_00031775 predicted 2558
4 SASI_Mm01_00031776 predicted 392
5 SASI_Mm01_00031777 predicted 1234
6 SASI_Mm02_00315078 predicted 2257
7 SASI_Mm01_00031778 predicted 3199
8 SASI_Mm01_00031779 predicted 1046
9 SASI_Mm01_00031780 predicted 4090
10 SASI_Mm01_00031781 predicted 1113
11 SASI_Mm01_00031782 predicted 1399
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008984
VALIDATED
PTPRM MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase, receptor type, M
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008984.1-4189s1c1
Sequence:CCGGCCACTGCACATCCGTAGTTATCTCGAGATAACTACGGATGTGCAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008984.1-432s1c1
Sequence:CCGGGCTGCCTCTTTGATGAACCATCTCGAGATGGTTCATCAAAGAGGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008984.1-686s1c1
Sequence:CCGGCCTGGGTTGCTCAATGTCTATCTCGAGATAGACATTGAGCAACCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008984.1-1936s1c1
Sequence:CCGGCCCGGAAATAGATTTATCCAACTCGAGTTGGATAAATCTATTTCCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008984.1-2124s1c1
Sequence:CCGGCCTATGAATTTGAGACACCTTCTCGAGAAGGTGTCTCAAATTCATAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008984.2-1246s21c1
Sequence:CCGGCTACGCAGAATTGGTAGTTAACTCGAGTTAACTACCAATTCTGCGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008984.2-4166s21c1
Sequence:CCGGGCCCTAATGGACAGCTATAAACTCGAGTTTATAGCTGTCCATTAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008984.2-1156s21c1
Sequence:CCGGAGCCTCATTTAACGTTGTAAACTCGAGTTTACAACGTTAAATGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338028    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008984.2-5024s21c1
Sequence:CCGGCTGTTAGAGCAGCGTAGATATCTCGAGATATCTACGCTGCTCTAACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008984.2-945s21c1
Sequence:CCGGTCGATGAAGTTAAGGTCTTAGCTCGAGCTAAGACCTTAACTTCATCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008984
VALIDATED
PTPRM MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase, receptor type, M
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008984.1-4189s1c1
Sequence:CCGGCCACTGCACATCCGTAGTTATCTCGAGATAACTACGGATGTGCAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008984.1-432s1c1
Sequence:CCGGGCTGCCTCTTTGATGAACCATCTCGAGATGGTTCATCAAAGAGGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008984.1-686s1c1
Sequence:CCGGCCTGGGTTGCTCAATGTCTATCTCGAGATAGACATTGAGCAACCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008984.1-1936s1c1
Sequence:CCGGCCCGGAAATAGATTTATCCAACTCGAGTTGGATAAATCTATTTCCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008984.1-2124s1c1
Sequence:CCGGCCTATGAATTTGAGACACCTTCTCGAGAAGGTGTCTCAAATTCATAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008984.2-1246s21c1
Sequence:CCGGCTACGCAGAATTGGTAGTTAACTCGAGTTAACTACCAATTCTGCGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008984.2-4166s21c1
Sequence:CCGGGCCCTAATGGACAGCTATAAACTCGAGTTTATAGCTGTCCATTAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008984.2-1156s21c1
Sequence:CCGGAGCCTCATTTAACGTTGTAAACTCGAGTTTACAACGTTAAATGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338028    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008984.2-5024s21c1
Sequence:CCGGCTGTTAGAGCAGCGTAGATATCTCGAGATATCTACGCTGCTCTAACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008984.2-945s21c1
Sequence:CCGGTCGATGAAGTTAAGGTCTTAGCTCGAGCTAAGACCTTAACTTCATCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008984
VALIDATED
PTPRM MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase, receptor type, M
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008984.1-4189s1c1
Sequence:CCGGCCACTGCACATCCGTAGTTATCTCGAGATAACTACGGATGTGCAGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008984.1-432s1c1
Sequence:CCGGGCTGCCTCTTTGATGAACCATCTCGAGATGGTTCATCAAAGAGGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008984.1-686s1c1
Sequence:CCGGCCTGGGTTGCTCAATGTCTATCTCGAGATAGACATTGAGCAACCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008984.1-1936s1c1
Sequence:CCGGCCCGGAAATAGATTTATCCAACTCGAGTTGGATAAATCTATTTCCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008984.1-2124s1c1
Sequence:CCGGCCTATGAATTTGAGACACCTTCTCGAGAAGGTGTCTCAAATTCATAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008984.2-1246s21c1
Sequence:CCGGCTACGCAGAATTGGTAGTTAACTCGAGTTAACTACCAATTCTGCGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008984.2-4166s21c1
Sequence:CCGGGCCCTAATGGACAGCTATAAACTCGAGTTTATAGCTGTCCATTAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008984.2-1156s21c1
Sequence:CCGGAGCCTCATTTAACGTTGTAAACTCGAGTTTACAACGTTAAATGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338028    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008984.2-5024s21c1
Sequence:CCGGCTGTTAGAGCAGCGTAGATATCTCGAGATATCTACGCTGCTCTAACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008984.2-945s21c1
Sequence:CCGGTCGATGAAGTTAAGGTCTTAGCTCGAGCTAAGACCTTAACTTCATCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002845
VALIDATED
PTPRM MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase, receptor type, M
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000273324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002845.3-2750s21c1
Sequence:CCGGCATCTTGCTGTTCGTGATTATCTCGAGATAATCACGAACAGCAAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002845.x-3736s1c1
Sequence:CCGGGCCCTCATGGACAGCTATAAACTCGAGTTTATAGCTGTCCATGAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002845.x-1323s1c1
Sequence:CCGGCCCTCAACACACGATCACTAACTCGAGTTAGTGATCGTGTGTTGAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002882    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_002845.x-4874s1c1
Sequence:CCGGGAGTCGTCGTTTCTGTCAGATCTCGAGATCTGACAGAAACGACGACTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_002845.x-715s1c1
Sequence:CCGGCGACGCTTCATTGCTTCATTTCTCGAGAAATGAAGCAATGAAGCGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_002845.x-2523s1c1
Sequence:CCGGCCCAGATGAAACCCACACAATCTCGAGATTGTGTGGGTTTCATCTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002845.3-1218s21c1
Sequence:CCGGCGACGCTTCATTGCTTCATTTCTCGAGAAATGAAGCAATGAAGCGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002845.3-3026s21c1
Sequence:CCGGCCCAGATGAAACCCACACAATCTCGAGATTGTGTGGGTTTCATCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002845.3-1319s21c1
Sequence:GTACCGGCTATGCAGAGTTGGTAGTTAACTCGAGTTAACTACCAACTCTGCATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379486    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002845.3-5250s21c1
Sequence:GTACCGGGCTATCTGGCATTATGGTAATCTCGAGATTACCATAATGCCAGATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002845.3-1500s21c1
Sequence:CCGGGTCGATTCCACGAGCTATAAACTCGAGTTTATAGCTCGTGGAATCGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273327    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002845.3-4907s21c1
Sequence:CCGGCAAGACGTTCCATGGTATTTGCTCGAGCAAATACCATGGAACGTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002845
VALIDATED
PTPRM MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase, receptor type, M
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000273324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002845.3-2750s21c1
Sequence:CCGGCATCTTGCTGTTCGTGATTATCTCGAGATAATCACGAACAGCAAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002845.x-3736s1c1
Sequence:CCGGGCCCTCATGGACAGCTATAAACTCGAGTTTATAGCTGTCCATGAGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002845.x-1323s1c1
Sequence:CCGGCCCTCAACACACGATCACTAACTCGAGTTAGTGATCGTGTGTTGAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002882    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_002845.x-4874s1c1
Sequence:CCGGGAGTCGTCGTTTCTGTCAGATCTCGAGATCTGACAGAAACGACGACTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_002845.x-715s1c1
Sequence:CCGGCGACGCTTCATTGCTTCATTTCTCGAGAAATGAAGCAATGAAGCGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_002845.x-2523s1c1
Sequence:CCGGCCCAGATGAAACCCACACAATCTCGAGATTGTGTGGGTTTCATCTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002845.3-1218s21c1
Sequence:CCGGCGACGCTTCATTGCTTCATTTCTCGAGAAATGAAGCAATGAAGCGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002845.3-3026s21c1
Sequence:CCGGCCCAGATGAAACCCACACAATCTCGAGATTGTGTGGGTTTCATCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002845.3-1319s21c1
Sequence:GTACCGGCTATGCAGAGTTGGTAGTTAACTCGAGTTAACTACCAACTCTGCATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379486    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002845.3-5250s21c1
Sequence:GTACCGGGCTATCTGGCATTATGGTAATCTCGAGATTACCATAATGCCAGATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002845.3-1500s21c1
Sequence:CCGGGTCGATTCCACGAGCTATAAACTCGAGTTTATAGCTCGTGGAATCGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273327    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002845.3-4907s21c1
Sequence:CCGGCAAGACGTTCCATGGTATTTGCTCGAGCAAATACCATGGAACGTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002845
VALIDATED
PTPRM MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase, receptor type, M
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000273324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002845.3-2750s21c1
Sequence:CCGGCATCTTGCTGTTCGTGATTATCTCGAGATAATCACGAACAGCAAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002845.x-3736s1c1
Sequence:CCGGGCCCTCATGGACAGCTATAAACTCGAGTTTATAGCTGTCCATGAGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002845.x-1323s1c1
Sequence:CCGGCCCTCAACACACGATCACTAACTCGAGTTAGTGATCGTGTGTTGAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002882    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_002845.x-4874s1c1
Sequence:CCGGGAGTCGTCGTTTCTGTCAGATCTCGAGATCTGACAGAAACGACGACTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_002845.x-715s1c1
Sequence:CCGGCGACGCTTCATTGCTTCATTTCTCGAGAAATGAAGCAATGAAGCGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_002845.x-2523s1c1
Sequence:CCGGCCCAGATGAAACCCACACAATCTCGAGATTGTGTGGGTTTCATCTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002845.3-1218s21c1
Sequence:CCGGCGACGCTTCATTGCTTCATTTCTCGAGAAATGAAGCAATGAAGCGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002845.3-3026s21c1
Sequence:CCGGCCCAGATGAAACCCACACAATCTCGAGATTGTGTGGGTTTCATCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002845.3-1319s21c1
Sequence:GTACCGGCTATGCAGAGTTGGTAGTTAACTCGAGTTAACTACCAACTCTGCATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379486    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002845.3-5250s21c1
Sequence:GTACCGGGCTATCTGGCATTATGGTAATCTCGAGATTACCATAATGCCAGATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002845.3-1500s21c1
Sequence:CCGGGTCGATTCCACGAGCTATAAACTCGAGTTTATAGCTCGTGGAATCGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273327    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002845.3-4907s21c1
Sequence:CCGGCAAGACGTTCCATGGTATTTGCTCGAGCAAATACCATGGAACGTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)