EMAIL THIS PAGE TO A FRIEND

PTPRN2

protein tyrosine phosphatase, receptor type, N polypeptide 2

86 Gene Product Result for
Synonyms: IA-2beta IAR ICAAR PTPRP R-PTP-N2
UniProtKB ID: Q92932, E9PC57, Q8N4I5, Q92662, Q9Y4F8, Q9Y4I6
Gene ID:
Human(5799) Summary: The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and a single intracellular catalytic domain, and thus represents a receptor-type PTP. The catalytic domain of this PTP is most closely related to PTPRN/IA-2beta. This PTP and PTPRN are both found to be major autoantigens associated with insulin-dependent diabetes mellitus. Three alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
Mouse(19276) protein tyrosine phosphatase, receptor type, N polypeptide 2
Rat(29714) protein tyrosine phosphatase, receptor type, N polypeptide 2
domestic guinea pig(100723726) protein tyrosine phosphatase, receptor type, N polypeptide 2
naked mole-rat(101716326) protein tyrosine phosphatase, receptor type, N polypeptide 2
Domestic Rabbit(100340246) protein tyrosine phosphatase, receptor type, N polypeptide 2
cow(616515) protein tyrosine phosphatase, receptor type, N polypeptide 2
Zebrafish(325033) protein tyrosine phosphatase, receptor type, N polypeptide 2
Horse(100067294) protein tyrosine phosphatase, receptor type, N polypeptide 2
dog(482825) protein tyrosine phosphatase, receptor type, N polypeptide 2
domestic cat(101089683) protein tyrosine phosphatase, receptor type, N polypeptide 2
chicken(420449) protein tyrosine phosphatase, receptor type, N polypeptide 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002847 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002847 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002847 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011215 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011215 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011215 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002847 Rosetta Predictions human pricing
NM_130842 Rosetta Predictions human pricing
NM_130843 Rosetta Predictions human pricing
NM_031600 Rosetta Predictions rat pricing
NM_011215 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002847 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166274 predicted 3029
2 SASI_Hs01_00166276 predicted 2644
3 SASI_Hs01_00166277 predicted 2780
4 SASI_Hs01_00166278 predicted 2638
5 SASI_Hs01_00166279 predicted 2572
6 SASI_Hs02_00334585 predicted 1352
7 SASI_Hs01_00166280 predicted 2233
8 SASI_Hs01_00166281 predicted 1374
9 SASI_Hs01_00166282 predicted 600
10 SASI_Hs01_00166283 predicted 2721
11 SASI_Hs01_00166275 predicted 2865
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130842 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147962 predicted 2978
2 SASI_Hs01_00147964 predicted 2600
3 SASI_Hs01_00147965 predicted 2730
4 SASI_Hs01_00147966 predicted 2586
5 SASI_Hs01_00147967 predicted 2515
6 SASI_Hs02_00362886 predicted 1306
7 SASI_Hs01_00147968 predicted 2190
8 SASI_Hs01_00147969 predicted 1317
9 SASI_Hs01_00147970 predicted 549
10 SASI_Hs01_00147971 predicted 2667
11 SASI_Hs01_00147963 predicted 2819
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130843 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012031 predicted 2941
2 SASI_Hs01_00012033 predicted 2556
3 SASI_Hs01_00012034 predicted 2690
4 SASI_Hs01_00012035 predicted 2543
5 SASI_Hs01_00012036 predicted 2483
6 SASI_Hs02_00362887 predicted 1352
7 SASI_Hs01_00012037 predicted 2145
8 SASI_Hs01_00012038 predicted 1366
9 SASI_Hs01_00012039 predicted 600
10 SASI_Hs01_00012040 predicted 2627
11 SASI_Hs01_00012032 predicted 2777
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031600 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00264879 predicted 2020
2 SASI_Rn01_00053604 predicted 1910
3 SASI_Rn01_00053605 predicted 2978
4 SASI_Rn01_00053606 predicted 2926
5 SASI_Rn01_00053607 predicted 2712
6 SASI_Rn01_00053608 predicted 682
7 SASI_Rn01_00053609 predicted 2937
8 SASI_Rn01_00053610 predicted 984
9 SASI_Rn01_00053612 predicted 482
10 SASI_Rn01_00053613 predicted 2230
11 SASI_Rn01_00053611 predicted 2673
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011215 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00161102 predicted 1516
2 SASI_Mm01_00161103 predicted 1763
3 SASI_Mm01_00161104 predicted 907
4 SASI_Mm01_00161105 predicted 2618
5 SASI_Mm01_00161106 predicted 2890
6 SASI_Mm01_00161107 predicted 946
7 SASI_Mm01_00161108 predicted 2840
8 SASI_Mm01_00161109 predicted 1815
9 SASI_Mm01_00161110 predicted 2855
10 SASI_Mm01_00161111 predicted 608
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002847
VALIDATED
PTPRN2 MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase, receptor type, N polypeptide 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002847.x-2650s1c1
Sequence:CCGGTCCAATCTCTACCACATCTATCTCGAGATAGATGTGGTAGAGATTGGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_002847.x-2958s1c1
Sequence:CCGGAGGTGCTAAAGAGATTGATATCTCGAGATATCAATCTCTTTAGCACCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_002847.x-1206s1c1
Sequence:CCGGCGACGATGATAGACTTTACCACTCGAGTGGTAAAGTCTATCATCGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003250    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002847.x-4243s1c1
Sequence:CCGGGCACGTAGAGATGATTCGGATCTCGAGATCCGAATCATCTCTACGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002847.x-1398s1c1
Sequence:CCGGCAAGAGCCAGACGTATTCCAACTCGAGTTGGAATACGTCTGGCTCTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002847.3-1459s21c1
Sequence:CCGGCGTCAAGAGCCAGACGTATTCCTCGAGGAATACGTCTGGCTCTTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002847.3-1267s21c1
Sequence:CCGGGGACGACGATGATAGACTTTACTCGAGTAAAGTCTATCATCGTCGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002847.3-1842s21c1
Sequence:GTACCGGCAGTTGACAACAAAGACAAACCTCGAGGTTTGTCTTTGTTGTCAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002847.3-4309s21c1
Sequence:GTACCGGACGTAGAGATGATTCGGATTTCTCGAGAAATCCGAATCATCTCTACGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002847.3-402s21c1
Sequence:CCGGTCACGTGGCAGGATGACTATACTCGAGTATAGTCATCCTGCCACGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002847
VALIDATED
PTPRN2 MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase, receptor type, N polypeptide 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002847.x-2650s1c1
Sequence:CCGGTCCAATCTCTACCACATCTATCTCGAGATAGATGTGGTAGAGATTGGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_002847.x-2958s1c1
Sequence:CCGGAGGTGCTAAAGAGATTGATATCTCGAGATATCAATCTCTTTAGCACCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_002847.x-1206s1c1
Sequence:CCGGCGACGATGATAGACTTTACCACTCGAGTGGTAAAGTCTATCATCGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003250    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002847.x-4243s1c1
Sequence:CCGGGCACGTAGAGATGATTCGGATCTCGAGATCCGAATCATCTCTACGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002847.x-1398s1c1
Sequence:CCGGCAAGAGCCAGACGTATTCCAACTCGAGTTGGAATACGTCTGGCTCTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002847.3-1459s21c1
Sequence:CCGGCGTCAAGAGCCAGACGTATTCCTCGAGGAATACGTCTGGCTCTTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002847.3-1267s21c1
Sequence:CCGGGGACGACGATGATAGACTTTACTCGAGTAAAGTCTATCATCGTCGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002847.3-1842s21c1
Sequence:GTACCGGCAGTTGACAACAAAGACAAACCTCGAGGTTTGTCTTTGTTGTCAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002847.3-4309s21c1
Sequence:GTACCGGACGTAGAGATGATTCGGATTTCTCGAGAAATCCGAATCATCTCTACGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002847.3-402s21c1
Sequence:CCGGTCACGTGGCAGGATGACTATACTCGAGTATAGTCATCCTGCCACGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002847
VALIDATED
PTPRN2 MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase, receptor type, N polypeptide 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002847.x-2650s1c1
Sequence:CCGGTCCAATCTCTACCACATCTATCTCGAGATAGATGTGGTAGAGATTGGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_002847.x-2958s1c1
Sequence:CCGGAGGTGCTAAAGAGATTGATATCTCGAGATATCAATCTCTTTAGCACCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_002847.x-1206s1c1
Sequence:CCGGCGACGATGATAGACTTTACCACTCGAGTGGTAAAGTCTATCATCGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003250    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002847.x-4243s1c1
Sequence:CCGGGCACGTAGAGATGATTCGGATCTCGAGATCCGAATCATCTCTACGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002847.x-1398s1c1
Sequence:CCGGCAAGAGCCAGACGTATTCCAACTCGAGTTGGAATACGTCTGGCTCTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002847.3-1459s21c1
Sequence:CCGGCGTCAAGAGCCAGACGTATTCCTCGAGGAATACGTCTGGCTCTTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002847.3-1267s21c1
Sequence:CCGGGGACGACGATGATAGACTTTACTCGAGTAAAGTCTATCATCGTCGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002847.3-1842s21c1
Sequence:GTACCGGCAGTTGACAACAAAGACAAACCTCGAGGTTTGTCTTTGTTGTCAACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002847.3-4309s21c1
Sequence:GTACCGGACGTAGAGATGATTCGGATTTCTCGAGAAATCCGAATCATCTCTACGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002847.3-402s21c1
Sequence:CCGGTCACGTGGCAGGATGACTATACTCGAGTATAGTCATCCTGCCACGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011215
PTPRN2 MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase, receptor type, N polypeptide 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011215.1-272s1c1
Sequence:CCGGCCTGAAGGTCACCTTACAGAACTCGAGTTCTGTAAGGTGACCTTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011215.1-2858s1c1
Sequence:CCGGCCTGATTGACATGGTTCTCAACTCGAGTTGAGAACCATGTCAATCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011215.1-722s1c1
Sequence:CCGGCGGTGACATAGACAAACAGAACTCGAGTTCTGTTTGTCTATGTCACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011215.1-1355s1c1
Sequence:CCGGCCTATTTGAAAGGAAACCAAACTCGAGTTTGGTTTCCTTTCAAATAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011215.1-1104s1c1
Sequence:CCGGCCAGAGACAATGCTTCAAGATCTCGAGATCTTGAAGCATTGTCTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011215
PTPRN2 MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase, receptor type, N polypeptide 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011215.1-272s1c1
Sequence:CCGGCCTGAAGGTCACCTTACAGAACTCGAGTTCTGTAAGGTGACCTTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011215.1-2858s1c1
Sequence:CCGGCCTGATTGACATGGTTCTCAACTCGAGTTGAGAACCATGTCAATCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011215.1-722s1c1
Sequence:CCGGCGGTGACATAGACAAACAGAACTCGAGTTCTGTTTGTCTATGTCACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011215.1-1355s1c1
Sequence:CCGGCCTATTTGAAAGGAAACCAAACTCGAGTTTGGTTTCCTTTCAAATAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011215.1-1104s1c1
Sequence:CCGGCCAGAGACAATGCTTCAAGATCTCGAGATCTTGAAGCATTGTCTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011215
PTPRN2 MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase, receptor type, N polypeptide 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011215.1-272s1c1
Sequence:CCGGCCTGAAGGTCACCTTACAGAACTCGAGTTCTGTAAGGTGACCTTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011215.1-2858s1c1
Sequence:CCGGCCTGATTGACATGGTTCTCAACTCGAGTTGAGAACCATGTCAATCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011215.1-722s1c1
Sequence:CCGGCGGTGACATAGACAAACAGAACTCGAGTTCTGTTTGTCTATGTCACCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011215.1-1355s1c1
Sequence:CCGGCCTATTTGAAAGGAAACCAAACTCGAGTTTGGTTTCCTTTCAAATAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011215.1-1104s1c1
Sequence:CCGGCCAGAGACAATGCTTCAAGATCTCGAGATCTTGAAGCATTGTCTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)