EMAIL THIS PAGE TO A FRIEND

PTPRR

protein tyrosine phosphatase, receptor type, R

149 Gene Product Result for
Synonyms: EC-PTP PCPTP1 PTP-SL PTPBR7 PTPRQ
Gene ID:
Human(5801) Summary: The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and a single intracellular catalytic domain, and thus represents a receptor-type PTP. Silencing of this gene has been associated with colorectal cancer. Multiple transcript variants encoding different isoforms have been found for this gene. This gene shares a symbol (PTPRQ) with another gene, protein tyrosine phosphatase, receptor type, Q (GeneID 374462), which is also located on chromosome 12. [provided by RefSeq, May 2011]
Mouse(19279) protein tyrosine phosphatase, receptor type, R
Rat(94202) protein tyrosine phosphatase, receptor type, R
Zebrafish(100526652) protein tyrosine phosphatase, receptor type, r
chicken(771985) protein tyrosine phosphatase, receptor type, R
dog(481163) protein tyrosine phosphatase, receptor type, R
Horse(100063646) protein tyrosine phosphatase, receptor type, R
domestic cat(101080463) protein tyrosine phosphatase, receptor type, R
cow(536337) protein tyrosine phosphatase, receptor type, R
sheep(101121162) protein tyrosine phosphatase, receptor type, R
naked mole-rat(101720052) protein tyrosine phosphatase, receptor type, R
Domestic Rabbit(100351238) protein tyrosine phosphatase, receptor type, R
domestic guinea pig(100715069) protein tyrosine phosphatase, receptor type, R
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011217 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011217 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011217 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002849 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002849 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002849 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU078991 MISSION® esiRNA esiRNA human PTPRR (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002849 Rosetta Predictions human pricing
NM_130846 Rosetta Predictions human pricing
NM_001113390 Rosetta Predictions rat pricing
NM_053594 Rosetta Predictions rat pricing
NM_011217 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002849 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00334588 predicted 1645
2 SASI_Hs01_00089319 predicted 1404
3 SASI_Hs01_00089320 predicted 2319
4 SASI_Hs01_00089322 predicted 1430
5 SASI_Hs01_00089323 predicted 1733
6 SASI_Hs01_00089324 predicted 1301
7 SASI_Hs01_00089325 predicted 2044
8 SASI_Hs01_00089326 predicted 2064
9 SASI_Hs01_00089327 predicted 1544
10 SASI_Hs01_00089328 predicted 2400
11 SASI_Hs01_00089321 predicted 1467
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130846 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00362889 predicted 882
2 SASI_Hs01_00058129 predicted 644
3 SASI_Hs01_00058130 predicted 1560
4 SASI_Hs01_00058132 predicted 676
5 SASI_Hs01_00058133 predicted 978
6 SASI_Hs01_00058134 predicted 540
7 SASI_Hs01_00058135 predicted 1284
8 SASI_Hs01_00058136 predicted 1308
9 SASI_Hs01_00058137 predicted 784
10 SASI_Hs01_00058138 predicted 1634
11 SASI_Hs01_00058131 predicted 714
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113390 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251803 predicted 361
2 SASI_Rn02_00251804 predicted 1089
3 SASI_Rn02_00251805 predicted 1323
4 SASI_Rn02_00251806 predicted 1824
5 SASI_Rn02_00251807 predicted 1092
6 SASI_Rn02_00251808 predicted 651
7 SASI_Rn02_00251809 predicted 949
8 SASI_Rn02_00251810 predicted 1397
9 SASI_Rn02_00251811 predicted 1744
10 SASI_Rn02_00251812 predicted 748
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053594 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00266272 predicted 1068
2 SASI_Rn01_00036763 predicted 1795
3 SASI_Rn01_00036764 predicted 2038
4 SASI_Rn01_00036766 predicted 2536
5 SASI_Rn01_00036767 predicted 1799
6 SASI_Rn01_00036768 predicted 1364
7 SASI_Rn01_00036769 predicted 1651
8 SASI_Rn01_00036770 predicted 2105
9 SASI_Rn01_00036771 predicted 2453
10 SASI_Rn01_00036772 predicted 1457
11 SASI_Rn01_00036765 predicted 2216
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011217 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025925 predicted 801
2 SASI_Mm01_00025926 predicted 1875
3 SASI_Mm01_00025927 predicted 2252
4 SASI_Mm01_00025928 predicted 942
5 SASI_Mm01_00025929 predicted 686
6 SASI_Mm01_00025930 predicted 931
7 SASI_Mm01_00025931 predicted 612
8 SASI_Mm01_00025932 predicted 1573
9 SASI_Mm01_00025933 predicted 573
10 SASI_Mm02_00320170 predicted 1070
11 SASI_Mm01_00025924 predicted 420
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011217
PTPRR MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase, receptor type, R
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000452851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011217.2-2226s21c1
Sequence:CCGGGTTGTAGACGCACTAAGTATTCTCGAGAATACTTAGTGCGTCTACAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011217.2-2355s21c1
Sequence:CCGGGTCGAGTGACTCCGAAGATTTCTCGAGAAATCTTCGGAGTCACTCGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011217.1-1521s1c1
Sequence:CCGGCCCACCTACTTCAAAGTGAATCTCGAGATTCACTTTGAAGTAGGTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011217.1-2150s1c1
Sequence:CCGGGCTACATCCATTGGCTGTCAACTCGAGTTGACAGCCAATGGATGTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011217.1-1120s1c1
Sequence:CCGGGCTTTCCTTAAGACAAGATAACTCGAGTTATCTTGTCTTAAGGAAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011217.1-1361s1c1
Sequence:CCGGCGAGGTTCCAATGTATCTCTTCTCGAGAAGAGATACATTGGAACCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011217.1-474s1c1
Sequence:CCGGCGGTGTTCATTTATGACCATTCTCGAGAATGGTCATAAATGAACACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000449756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011217.2-1707s21c1
Sequence:CCGGACCGATTCCTTGAGTACTTACCTCGAGGTAAGTACTCAAGGAATCGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011217
PTPRR MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase, receptor type, R
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000452851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011217.2-2226s21c1
Sequence:CCGGGTTGTAGACGCACTAAGTATTCTCGAGAATACTTAGTGCGTCTACAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000445401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011217.2-2355s21c1
Sequence:CCGGGTCGAGTGACTCCGAAGATTTCTCGAGAAATCTTCGGAGTCACTCGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011217.1-1521s1c1
Sequence:CCGGCCCACCTACTTCAAAGTGAATCTCGAGATTCACTTTGAAGTAGGTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011217.1-2150s1c1
Sequence:CCGGGCTACATCCATTGGCTGTCAACTCGAGTTGACAGCCAATGGATGTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011217.1-1120s1c1
Sequence:CCGGGCTTTCCTTAAGACAAGATAACTCGAGTTATCTTGTCTTAAGGAAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011217.1-1361s1c1
Sequence:CCGGCGAGGTTCCAATGTATCTCTTCTCGAGAAGAGATACATTGGAACCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011217.1-474s1c1
Sequence:CCGGCGGTGTTCATTTATGACCATTCTCGAGAATGGTCATAAATGAACACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000449756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011217.2-1707s21c1
Sequence:CCGGACCGATTCCTTGAGTACTTACCTCGAGGTAAGTACTCAAGGAATCGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011217
PTPRR MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase, receptor type, R
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000452851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011217.2-2226s21c1
Sequence:CCGGGTTGTAGACGCACTAAGTATTCTCGAGAATACTTAGTGCGTCTACAACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000445401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011217.2-2355s21c1
Sequence:CCGGGTCGAGTGACTCCGAAGATTTCTCGAGAAATCTTCGGAGTCACTCGACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011217.1-1521s1c1
Sequence:CCGGCCCACCTACTTCAAAGTGAATCTCGAGATTCACTTTGAAGTAGGTGGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011217.1-2150s1c1
Sequence:CCGGGCTACATCCATTGGCTGTCAACTCGAGTTGACAGCCAATGGATGTAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011217.1-1120s1c1
Sequence:CCGGGCTTTCCTTAAGACAAGATAACTCGAGTTATCTTGTCTTAAGGAAAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011217.1-1361s1c1
Sequence:CCGGCGAGGTTCCAATGTATCTCTTCTCGAGAAGAGATACATTGGAACCTCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011217.1-474s1c1
Sequence:CCGGCGGTGTTCATTTATGACCATTCTCGAGAATGGTCATAAATGAACACCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000449756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011217.2-1707s21c1
Sequence:CCGGACCGATTCCTTGAGTACTTACCTCGAGGTAAGTACTCAAGGAATCGGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002849
PTPRR MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase, receptor type, R
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000355566    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002849.2-2616s21c1
Sequence:CCGGATGGAGGTATGATAGGTTTATCTCGAGATAAACCTATCATACCTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002849.2-482s21c1
Sequence:CCGGTTCAGGAAACAATGATCATTTCTCGAGAAATGATCATTGTTTCCTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002849.x-1832s1c1
Sequence:CCGGCGTGGATGATTTCTGGCAGATCTCGAGATCTGCCAGAAATCATCCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002849.x-1415s1c1
Sequence:CCGGTCAAGAGAGAAGAGGGTCCAACTCGAGTTGGACCCTCTTCTCTCTTGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002849.x-883s1c1
Sequence:CCGGTCATTGGAAAGAAGAACAGTACTCGAGTACTGTTCTTCTTTCCAATGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002849.2-1739s21c1
Sequence:CCGGTTCATTGAGCACCTACATTAACTCGAGTTAATGTAGGTGCTCAATGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355625    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002849.2-2747s21c1
Sequence:CCGGTGCTGAAGACATTCGTATTATCTCGAGATAATACGAATGTCTTCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002908    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002849.x-2528s1c1
Sequence:CCGGCTGGGCAACATATTTAAGATTCTCGAGAATCTTAAATATGTTGCCCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002849.x-666s1c1
Sequence:CCGGGCATTTCCTAGACCCGCATATCTCGAGATATGCGGGTCTAGGAAATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002849
PTPRR MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase, receptor type, R
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000355566    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002849.2-2616s21c1
Sequence:CCGGATGGAGGTATGATAGGTTTATCTCGAGATAAACCTATCATACCTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002849.2-482s21c1
Sequence:CCGGTTCAGGAAACAATGATCATTTCTCGAGAAATGATCATTGTTTCCTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002849.x-1832s1c1
Sequence:CCGGCGTGGATGATTTCTGGCAGATCTCGAGATCTGCCAGAAATCATCCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002849.x-1415s1c1
Sequence:CCGGTCAAGAGAGAAGAGGGTCCAACTCGAGTTGGACCCTCTTCTCTCTTGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002849.x-883s1c1
Sequence:CCGGTCATTGGAAAGAAGAACAGTACTCGAGTACTGTTCTTCTTTCCAATGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002849.2-1739s21c1
Sequence:CCGGTTCATTGAGCACCTACATTAACTCGAGTTAATGTAGGTGCTCAATGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355625    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002849.2-2747s21c1
Sequence:CCGGTGCTGAAGACATTCGTATTATCTCGAGATAATACGAATGTCTTCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002908    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002849.x-2528s1c1
Sequence:CCGGCTGGGCAACATATTTAAGATTCTCGAGAATCTTAAATATGTTGCCCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002849.x-666s1c1
Sequence:CCGGGCATTTCCTAGACCCGCATATCTCGAGATATGCGGGTCTAGGAAATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002849
PTPRR MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase, receptor type, R
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000355566    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002849.2-2616s21c1
Sequence:CCGGATGGAGGTATGATAGGTTTATCTCGAGATAAACCTATCATACCTCCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002849.2-482s21c1
Sequence:CCGGTTCAGGAAACAATGATCATTTCTCGAGAAATGATCATTGTTTCCTGAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002849.x-1832s1c1
Sequence:CCGGCGTGGATGATTTCTGGCAGATCTCGAGATCTGCCAGAAATCATCCACGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002849.x-1415s1c1
Sequence:CCGGTCAAGAGAGAAGAGGGTCCAACTCGAGTTGGACCCTCTTCTCTCTTGATTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002849.x-883s1c1
Sequence:CCGGTCATTGGAAAGAAGAACAGTACTCGAGTACTGTTCTTCTTTCCAATGATTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002849.2-1739s21c1
Sequence:CCGGTTCATTGAGCACCTACATTAACTCGAGTTAATGTAGGTGCTCAATGAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355625    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002849.2-2747s21c1
Sequence:CCGGTGCTGAAGACATTCGTATTATCTCGAGATAATACGAATGTCTTCAGCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002908    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002849.x-2528s1c1
Sequence:CCGGCTGGGCAACATATTTAAGATTCTCGAGAATCTTAAATATGTTGCCCAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002849.x-666s1c1
Sequence:CCGGGCATTTCCTAGACCCGCATATCTCGAGATATGCGGGTCTAGGAAATGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)