EMAIL THIS PAGE TO A FRIEND

PTPRS

protein tyrosine phosphatase, receptor type, S

99 Gene Product Result for
Synonyms: PTPSIGMA
UniProtKB ID: Q13332, O75255, O75870, Q15718, Q16341, Q2M3R7
Gene ID:
Human(5802) Summary: The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an extracellular region, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region of this protein is composed of multiple Ig-like and fibronectin type III-like domains. Studies of the similar gene in mice suggested that this PTP may be involved in cell-cell interaction, primary axonogenesis, and axon guidance during embryogenesis. This PTP has been also implicated in the molecular control of adult nerve repair. Four alternatively spliced transcript variants, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
Mouse(19280) protein tyrosine phosphatase, receptor type, S
Rat(25529) protein tyrosine phosphatase, receptor type, S
naked mole-rat(101715786) protein tyrosine phosphatase, receptor type, S
cow(537480) protein tyrosine phosphatase, receptor type, S
sheep(101112817) protein tyrosine phosphatase, receptor type, S
chicken(396375) protein tyrosine phosphatase, receptor type, S
dog(485030) protein tyrosine phosphatase, receptor type, S
Horse(100069183) protein tyrosine phosphatase, receptor type, S
domestic cat(101083913) protein tyrosine phosphatase, receptor type, S
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011218 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011218 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011218 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002850 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002850 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002850 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU058211 MISSION® esiRNA esiRNA targeting mouse Ptprs (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002850 siRNAs that have been validated in the lab human pricing
NM_130853 Rosetta Predictions human pricing
NM_130854 Rosetta Predictions human pricing
NM_130855 Rosetta Predictions human pricing
NM_019140 Rosetta Predictions rat pricing
NM_011218 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002850 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178595 validated 4725
1 SASI_Hs01_00178597 validated 4551
2 SASI_Hs01_00178596 predicted 436
3 SASI_Hs01_00178598 predicted 1307
4 SASI_Hs02_00334589 predicted 4766
5 SASI_Hs01_00178599 predicted 1372
6 SASI_Hs01_00178600 predicted 5676
7 SASI_Hs01_00178601 predicted 3906
8 SASI_Hs01_00178602 predicted 4577
9 SASI_Hs02_00334590 predicted 5067
10 SASI_Hs01_00178603 predicted 3870
11 SASI_Hs01_00178604 predicted 491
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130853 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107370 predicted 3385
2 SASI_Hs01_00107371 predicted 436
3 SASI_Hs01_00107372 predicted 3207
4 SASI_Hs01_00107373 predicted 1273
5 SASI_Hs02_00362900 predicted 3425
6 SASI_Hs01_00107374 predicted 1335
7 SASI_Hs01_00107375 predicted 4335
8 SASI_Hs01_00107376 predicted 2612
9 SASI_Hs01_00107377 predicted 3233
10 SASI_Hs02_00362901 predicted 3726
11 SASI_Hs01_00107378 predicted 2573
12 SASI_Hs01_00107379 predicted 492
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130854 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044397 predicted 4608
2 SASI_Hs01_00044398 predicted 438
3 SASI_Hs01_00044399 predicted 4435
4 SASI_Hs01_00044400 predicted 1268
5 SASI_Hs02_00362902 predicted 4654
6 SASI_Hs01_00044401 predicted 1335
7 SASI_Hs01_00044402 predicted 5561
8 SASI_Hs01_00044403 predicted 3836
9 SASI_Hs01_00044404 predicted 4462
10 SASI_Hs02_00362903 predicted 4952
11 SASI_Hs01_00044405 predicted 3800
12 SASI_Hs01_00044406 predicted 487
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130855 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026374 predicted 3392
2 SASI_Hs01_00026375 predicted 433
3 SASI_Hs01_00026376 predicted 3219
4 SASI_Hs01_00026377 predicted 1280
5 SASI_Hs02_00362904 predicted 3442
6 SASI_Hs01_00026378 predicted 1338
7 SASI_Hs01_00026379 predicted 4349
8 SASI_Hs01_00026380 predicted 2628
9 SASI_Hs01_00026381 predicted 3242
10 SASI_Hs02_00362905 predicted 3732
11 SASI_Hs01_00026382 predicted 2583
12 SASI_Hs01_00026383 predicted 485
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019140 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064359 predicted 4492
2 SASI_Rn01_00064361 predicted 5368
3 SASI_Rn01_00064362 predicted 3696
4 SASI_Rn02_00261900 predicted 3988
5 SASI_Rn01_00064365 predicted 5239
6 SASI_Rn01_00064366 predicted 4269
7 SASI_Rn01_00064367 predicted 389
8 SASI_Rn01_00064368 predicted 3247
9 SASI_Rn02_00261901 predicted 4774
10 SASI_Rn02_00261902 predicted 5438
11 SASI_Rn01_00064360 predicted 3175
12 SASI_Rn01_00064363 predicted 913
13 SASI_Rn01_00064364 predicted 1234
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011218 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00200560 predicted 5552
2 SASI_Mm01_00200561 predicted 1283
3 SASI_Mm01_00200562 predicted 4610
4 SASI_Mm02_00320171 predicted 2534
5 SASI_Mm01_00200563 predicted 4316
6 SASI_Mm01_00200564 predicted 3771
7 SASI_Mm01_00200565 predicted 5425
8 SASI_Mm01_00200566 predicted 4458
9 SASI_Mm01_00200568 predicted 1402
10 SASI_Mm01_00200569 predicted 3436
11 SASI_Mm01_00200567 predicted 3768
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011218
VALIDATED
PTPRS MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase, receptor type, S
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238009    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011218.2-6418s21c1
Sequence:CCGGGCTTCTGTGTGTGCATCTTTCCTCGAGGAAAGATGCACACACAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029994    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011218.1-5958s1c1
Sequence:CCGGCCTTCCTCATTCCCTTCTGATCTCGAGATCAGAAGGGAATGAGGAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011218.1-5206s1c1
Sequence:CCGGCCAGCTTTATCGACGGCTATACTCGAGTATAGCCGTCGATAAAGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011218.1-467s1c1
Sequence:CCGGCGAAATCACAATTCATGCAAACTCGAGTTTGCATGAATTGTGATTTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011218.1-1981s1c1
Sequence:CCGGCCACGGCCATATTGGTAAGTTCTCGAGAACTTACCAATATGGCCGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011218.1-3503s1c1
Sequence:CCGGGCAGAACTACTTCATTGTGATCTCGAGATCACAATGAAGTAGTTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011218.2-1009s21c1
Sequence:CCGGCACCCATGCCCTACGTGAAATCTCGAGATTTCACGTAGGGCATGGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011218.2-4742s21c1
Sequence:CCGGGAAGCGTGAGGTGCGACATTTCTCGAGAAATGTCGCACCTCACGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011218.2-1948s21c1
Sequence:CCGGTCAAGCCCAATACGGAGTATGCTCGAGCATACTCCGTATTGGGCTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011218.2-1273s21c1
Sequence:CCGGCCGTGTCCTACTACGTAATTGCTCGAGCAATTACGTAGTAGGACACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011218
VALIDATED
PTPRS MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase, receptor type, S
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238009    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011218.2-6418s21c1
Sequence:CCGGGCTTCTGTGTGTGCATCTTTCCTCGAGGAAAGATGCACACACAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029994    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011218.1-5958s1c1
Sequence:CCGGCCTTCCTCATTCCCTTCTGATCTCGAGATCAGAAGGGAATGAGGAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011218.1-5206s1c1
Sequence:CCGGCCAGCTTTATCGACGGCTATACTCGAGTATAGCCGTCGATAAAGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011218.1-467s1c1
Sequence:CCGGCGAAATCACAATTCATGCAAACTCGAGTTTGCATGAATTGTGATTTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011218.1-1981s1c1
Sequence:CCGGCCACGGCCATATTGGTAAGTTCTCGAGAACTTACCAATATGGCCGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011218.1-3503s1c1
Sequence:CCGGGCAGAACTACTTCATTGTGATCTCGAGATCACAATGAAGTAGTTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011218.2-1009s21c1
Sequence:CCGGCACCCATGCCCTACGTGAAATCTCGAGATTTCACGTAGGGCATGGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011218.2-4742s21c1
Sequence:CCGGGAAGCGTGAGGTGCGACATTTCTCGAGAAATGTCGCACCTCACGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011218.2-1948s21c1
Sequence:CCGGTCAAGCCCAATACGGAGTATGCTCGAGCATACTCCGTATTGGGCTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011218.2-1273s21c1
Sequence:CCGGCCGTGTCCTACTACGTAATTGCTCGAGCAATTACGTAGTAGGACACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011218
VALIDATED
PTPRS MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase, receptor type, S
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238009    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011218.2-6418s21c1
Sequence:CCGGGCTTCTGTGTGTGCATCTTTCCTCGAGGAAAGATGCACACACAGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029994    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011218.1-5958s1c1
Sequence:CCGGCCTTCCTCATTCCCTTCTGATCTCGAGATCAGAAGGGAATGAGGAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011218.1-5206s1c1
Sequence:CCGGCCAGCTTTATCGACGGCTATACTCGAGTATAGCCGTCGATAAAGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011218.1-467s1c1
Sequence:CCGGCGAAATCACAATTCATGCAAACTCGAGTTTGCATGAATTGTGATTTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011218.1-1981s1c1
Sequence:CCGGCCACGGCCATATTGGTAAGTTCTCGAGAACTTACCAATATGGCCGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011218.1-3503s1c1
Sequence:CCGGGCAGAACTACTTCATTGTGATCTCGAGATCACAATGAAGTAGTTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011218.2-1009s21c1
Sequence:CCGGCACCCATGCCCTACGTGAAATCTCGAGATTTCACGTAGGGCATGGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011218.2-4742s21c1
Sequence:CCGGGAAGCGTGAGGTGCGACATTTCTCGAGAAATGTCGCACCTCACGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011218.2-1948s21c1
Sequence:CCGGTCAAGCCCAATACGGAGTATGCTCGAGCATACTCCGTATTGGGCTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011218.2-1273s21c1
Sequence:CCGGCCGTGTCCTACTACGTAATTGCTCGAGCAATTACGTAGTAGGACACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002850
VALIDATED
PTPRS MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase, receptor type, S
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000002910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002850.x-3701s1c1
Sequence:CCGGCCAGAGCTATTTCATTGTGATCTCGAGATCACAATGAAATAGCTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002850.x-476s1c1
Sequence:CCGGGCGCTTTGAGACGATTGAGTTCTCGAGAACTCAATCGTCTCAAAGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_002850.x-4124s1c1
Sequence:CCGGCGTGGTCTTCATAATCTGCATCTCGAGATGCAGATTATGAAGACCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002914    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002850.x-6314s1c1
Sequence:CCGGTACTTGGCACATTCCTCCTTTCTCGAGAAAGGAGGAATGTGCCAAGTATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002850.x-1337s1c1
Sequence:CCGGCGTCATCGAATATAAATCCAACTCGAGTTGGATTTATATTCGATGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002850.3-462s21c1
Sequence:CCGGGCGCTTTGAGACGATTGAGTTCTCGAGAACTCAATCGTCTCAAAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002850.3-2590s21c1
Sequence:GTACCGGACGGATGACACGGCCGAATATCTCGAGATATTCGGCCGTGTCATCCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002850.3-4248s21c1
Sequence:GTACCGGTGTGGAAATGAGACGCATTAACTCGAGTTAATGCGTCTCATTTCCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002850.3-1316s21c1
Sequence:CCGGCCTATTACGTCATCGAATATACTCGAGTATATTCGATGACGTAATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320393    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002850.3-6301s21c1
Sequence:CCGGTACTTGGCACATTCCTCCTTTCTCGAGAAAGGAGGAATGTGCCAAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002850.3-4110s21c1
Sequence:CCGGCGTGGTCTTCATAATCTGCATCTCGAGATGCAGATTATGAAGACCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002850.3-856s21c1
Sequence:GTACCGGGAAACCGACCAGGGCAAATATCTCGAGATATTTGCCCTGGTCGGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002850
VALIDATED
PTPRS MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase, receptor type, S
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000002910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002850.x-3701s1c1
Sequence:CCGGCCAGAGCTATTTCATTGTGATCTCGAGATCACAATGAAATAGCTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002850.x-476s1c1
Sequence:CCGGGCGCTTTGAGACGATTGAGTTCTCGAGAACTCAATCGTCTCAAAGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_002850.x-4124s1c1
Sequence:CCGGCGTGGTCTTCATAATCTGCATCTCGAGATGCAGATTATGAAGACCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002914    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002850.x-6314s1c1
Sequence:CCGGTACTTGGCACATTCCTCCTTTCTCGAGAAAGGAGGAATGTGCCAAGTATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002850.x-1337s1c1
Sequence:CCGGCGTCATCGAATATAAATCCAACTCGAGTTGGATTTATATTCGATGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002850.3-462s21c1
Sequence:CCGGGCGCTTTGAGACGATTGAGTTCTCGAGAACTCAATCGTCTCAAAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002850.3-2590s21c1
Sequence:GTACCGGACGGATGACACGGCCGAATATCTCGAGATATTCGGCCGTGTCATCCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002850.3-4248s21c1
Sequence:GTACCGGTGTGGAAATGAGACGCATTAACTCGAGTTAATGCGTCTCATTTCCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002850.3-1316s21c1
Sequence:CCGGCCTATTACGTCATCGAATATACTCGAGTATATTCGATGACGTAATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320393    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002850.3-6301s21c1
Sequence:CCGGTACTTGGCACATTCCTCCTTTCTCGAGAAAGGAGGAATGTGCCAAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002850.3-4110s21c1
Sequence:CCGGCGTGGTCTTCATAATCTGCATCTCGAGATGCAGATTATGAAGACCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002850.3-856s21c1
Sequence:GTACCGGGAAACCGACCAGGGCAAATATCTCGAGATATTTGCCCTGGTCGGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002850
VALIDATED
PTPRS MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase, receptor type, S
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000002910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002850.x-3701s1c1
Sequence:CCGGCCAGAGCTATTTCATTGTGATCTCGAGATCACAATGAAATAGCTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002850.x-476s1c1
Sequence:CCGGGCGCTTTGAGACGATTGAGTTCTCGAGAACTCAATCGTCTCAAAGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_002850.x-4124s1c1
Sequence:CCGGCGTGGTCTTCATAATCTGCATCTCGAGATGCAGATTATGAAGACCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002914    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002850.x-6314s1c1
Sequence:CCGGTACTTGGCACATTCCTCCTTTCTCGAGAAAGGAGGAATGTGCCAAGTATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002850.x-1337s1c1
Sequence:CCGGCGTCATCGAATATAAATCCAACTCGAGTTGGATTTATATTCGATGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002850.3-462s21c1
Sequence:CCGGGCGCTTTGAGACGATTGAGTTCTCGAGAACTCAATCGTCTCAAAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002850.3-2590s21c1
Sequence:GTACCGGACGGATGACACGGCCGAATATCTCGAGATATTCGGCCGTGTCATCCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002850.3-4248s21c1
Sequence:GTACCGGTGTGGAAATGAGACGCATTAACTCGAGTTAATGCGTCTCATTTCCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002850.3-1316s21c1
Sequence:CCGGCCTATTACGTCATCGAATATACTCGAGTATATTCGATGACGTAATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320393    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002850.3-6301s21c1
Sequence:CCGGTACTTGGCACATTCCTCCTTTCTCGAGAAAGGAGGAATGTGCCAAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002850.3-4110s21c1
Sequence:CCGGCGTGGTCTTCATAATCTGCATCTCGAGATGCAGATTATGAAGACCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002850.3-856s21c1
Sequence:GTACCGGGAAACCGACCAGGGCAAATATCTCGAGATATTTGCCCTGGTCGGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)