EMAIL THIS PAGE TO A FRIEND

PTPRU

protein tyrosine phosphatase, receptor type, U

293 Gene Product Result for
Synonyms: FMI PCP-2 PTP PTP-J PTP-PI PTP-RO PTPPSI PTPRO PTPU2 R-PTP-PSI R-PTP-U hPTP-J
Gene ID:
Human(10076) Summary: The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracellular catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP (MAM) domain, Ig-like and fibronectin type III-like repeats. This PTP was thought to play roles in cell-cell recognition and adhesion. Studies of the similar gene in mice suggested the role of this PTP in early neural development. The expression of this gene was reported to be regulated by phorbol myristate acetate (PMA) or calcium ionophore in Jurkat T lymphoma cells. Alternatively spliced transcript variants have been reported. [provided by RefSeq, Aug 2010]
Mouse(19273) protein tyrosine phosphatase, receptor type, U
Rat(116680) protein tyrosine phosphatase, receptor type, U
domestic guinea pig(100715045) protein tyrosine phosphatase, receptor type, U
naked mole-rat(101725279) protein tyrosine phosphatase, receptor type, U
cow(535675) protein tyrosine phosphatase, receptor type, U
sheep(101108816) protein tyrosine phosphatase, receptor type, U
Zebrafish(100537682) protein tyrosine phosphatase, receptor type, U
chicken(395153) protein tyrosine phosphatase, receptor type, U
domestic cat(101092380) protein tyrosine phosphatase, receptor type, U
Horse(100070588) protein tyrosine phosphatase, receptor type, U
dog(487328) protein tyrosine phosphatase, receptor type, U
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011214 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011214 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011214 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005704 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005704 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005704 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005704 Rosetta Predictions human pricing
NM_133177 Rosetta Predictions human pricing
NM_133178 Rosetta Predictions human pricing
XM_001063025 Rosetta Predictions rat pricing
XM_342930 Rosetta Predictions rat pricing
NM_001083119 Rosetta Predictions mouse pricing
NM_011214 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005704 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00340110 predicted 4158
2 SASI_Hs02_00340111 predicted 1842
3 SASI_Hs02_00340112 predicted 556
4 SASI_Hs02_00340113 predicted 410
5 SASI_Hs02_00340114 predicted 552
6 SASI_Hs01_00180494 predicted 1604
7 SASI_Hs01_00180496 predicted 1153
8 SASI_Hs02_00340115 predicted 3378
9 SASI_Hs02_00340116 predicted 1849
10 SASI_Hs02_00340117 predicted 1742
11 SASI_Hs01_00180487 predicted 1686
12 SASI_Hs01_00180488 predicted 1388
13 SASI_Hs01_00180489 predicted 4412
14 SASI_Hs01_00180490 predicted 1257
15 SASI_Hs01_00180491 predicted 3414
16 SASI_Hs01_00180492 predicted 3536
17 SASI_Hs01_00180493 predicted 4905
18 SASI_Hs01_00180495 predicted 1584
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133177 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00362935 predicted 4154
2 SASI_Hs02_00362936 predicted 1845
3 SASI_Hs02_00362937 predicted 556
4 SASI_Hs02_00362938 predicted 410
5 SASI_Hs02_00362939 predicted 555
6 SASI_Hs01_00143824 predicted 1606
7 SASI_Hs01_00143826 predicted 1158
8 SASI_Hs02_00362940 predicted 3367
9 SASI_Hs02_00362941 predicted 1844
10 SASI_Hs02_00362942 predicted 1744
11 SASI_Hs01_00143817 predicted 1687
12 SASI_Hs01_00143818 predicted 1384
13 SASI_Hs01_00143819 predicted 4396
14 SASI_Hs01_00143820 predicted 1258
15 SASI_Hs01_00143821 predicted 3410
16 SASI_Hs01_00143822 predicted 3523
17 SASI_Hs01_00143823 predicted 4886
18 SASI_Hs01_00143825 predicted 1586
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133178 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00362943 predicted 4133
2 SASI_Hs02_00362944 predicted 1849
3 SASI_Hs02_00362945 predicted 563
4 SASI_Hs02_00362946 predicted 404
5 SASI_Hs02_00362947 predicted 556
6 SASI_Hs01_00078579 predicted 1603
7 SASI_Hs01_00078581 predicted 1159
8 SASI_Hs02_00362948 predicted 3350
9 SASI_Hs02_00362949 predicted 1850
10 SASI_Hs02_00362950 predicted 1748
11 SASI_Hs01_00078572 predicted 1691
12 SASI_Hs01_00078573 predicted 1393
13 SASI_Hs01_00078574 predicted 4379
14 SASI_Hs01_00078575 predicted 1258
15 SASI_Hs01_00078576 predicted 3390
16 SASI_Hs01_00078577 predicted 3505
17 SASI_Hs01_00078578 predicted 4878
18 SASI_Hs01_00078580 predicted 1581
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063025 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00305469 predicted 3185
2 SASI_Rn02_00305470 predicted 3230
3 SASI_Rn02_00305471 predicted 405
4 SASI_Rn02_00305472 predicted 4826
5 SASI_Rn02_00305473 predicted 3278
6 SASI_Rn02_00305474 predicted 3390
7 SASI_Rn02_00305475 predicted 2085
8 SASI_Rn02_00305476 predicted 3680
9 SASI_Rn02_00305477 predicted 926
10 SASI_Rn02_00305478 predicted 4205
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342930 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395041 predicted 3572
2 SASI_Rn02_00395042 predicted 3612
3 SASI_Rn02_00395043 predicted 3665
4 SASI_Rn02_00395044 predicted 3775
5 SASI_Rn02_00395045 predicted 2396
6 SASI_Rn02_00395046 predicted 4067
7 SASI_Rn02_00395047 predicted 1228
8 SASI_Rn02_00395048 predicted 4592
9 SASI_Rn02_00395049 predicted 4482
10 SASI_Rn02_00395050 predicted 1766
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083119 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299484 predicted 1766
2 SASI_Mm02_00299485 predicted 2940
3 SASI_Mm02_00299486 predicted 1577
4 SASI_Mm02_00299487 predicted 3000
5 SASI_Mm02_00299488 predicted 630
6 SASI_Mm02_00299489 predicted 243
7 SASI_Mm02_00299490 predicted 2211
8 SASI_Mm02_00299491 predicted 3612
9 SASI_Mm02_00299492 predicted 4371
10 SASI_Mm02_00299493 predicted 2883
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011214 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00023317 predicted 1768
2 SASI_Mm01_00023318 predicted 2910
3 SASI_Mm01_00023319 predicted 1576
4 SASI_Mm01_00023320 predicted 2965
5 SASI_Mm01_00023321 predicted 630
6 SASI_Mm02_00320164 predicted 244
7 SASI_Mm02_00320165 predicted 2209
8 SASI_Mm01_00023322 predicted 3579
9 SASI_Mm02_00320166 predicted 4342
10 SASI_Mm02_00320167 predicted 2856
11 SASI_Mm01_00023323 predicted 2483
12 SASI_Mm01_00023324 predicted 2530
13 SASI_Mm01_00023325 predicted 1493
14 SASI_Mm01_00023326 predicted 3021
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011214
PTPRU MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase, receptor type, U
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011214.1-3243s1c1
Sequence:CCGGGCCTGAGATGATCTACGATTTCTCGAGAAATCGTAGATCATCTCAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011214.1-2736s1c1
Sequence:CCGGCCAGGAGAAGACTCACATGATCTCGAGATCATGTGAGTCTTCTCCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011214.1-4167s1c1
Sequence:CCGGCGTCATGCTGAACCAACTTAACTCGAGTTAAGTTGGTTCAGCATGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011214.1-1758s1c1
Sequence:CCGGCGTGCGTCTGATTCTCACAAACTCGAGTTTGTGAGAATCAGACGCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011214.1-508s1c1
Sequence:CCGGGCTCAGTATGACGACTTCCAACTCGAGTTGGAAGTCGTCATACTGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011214
PTPRU MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase, receptor type, U
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011214.1-3243s1c1
Sequence:CCGGGCCTGAGATGATCTACGATTTCTCGAGAAATCGTAGATCATCTCAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011214.1-2736s1c1
Sequence:CCGGCCAGGAGAAGACTCACATGATCTCGAGATCATGTGAGTCTTCTCCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011214.1-4167s1c1
Sequence:CCGGCGTCATGCTGAACCAACTTAACTCGAGTTAAGTTGGTTCAGCATGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011214.1-1758s1c1
Sequence:CCGGCGTGCGTCTGATTCTCACAAACTCGAGTTTGTGAGAATCAGACGCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011214.1-508s1c1
Sequence:CCGGGCTCAGTATGACGACTTCCAACTCGAGTTGGAAGTCGTCATACTGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011214
PTPRU MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase, receptor type, U
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011214.1-3243s1c1
Sequence:CCGGGCCTGAGATGATCTACGATTTCTCGAGAAATCGTAGATCATCTCAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011214.1-2736s1c1
Sequence:CCGGCCAGGAGAAGACTCACATGATCTCGAGATCATGTGAGTCTTCTCCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011214.1-4167s1c1
Sequence:CCGGCGTCATGCTGAACCAACTTAACTCGAGTTAAGTTGGTTCAGCATGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011214.1-1758s1c1
Sequence:CCGGCGTGCGTCTGATTCTCACAAACTCGAGTTTGTGAGAATCAGACGCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011214.1-508s1c1
Sequence:CCGGGCTCAGTATGACGACTTCCAACTCGAGTTGGAAGTCGTCATACTGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005704
VALIDATED
PTPRU MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase, receptor type, U
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001847    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005704.x-5598s1c1
Sequence:CCGGACGTGCTCTCTGAATGCCAAACTCGAGTTTGGCATTCAGAGAGCACGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005704.x-4381s1c1
Sequence:CCGGCCGGAACTACAAACCCAACATCTCGAGATGTTGGGTTTGTAGTTCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005704.x-1906s1c1
Sequence:CCGGCAGCTTTGATTATGCCGACATCTCGAGATGTCGGCATAATCAAAGCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005704.x-528s1c1
Sequence:CCGGCTGTGTGGAATATGACTGGATCTCGAGATCCAGTCATATTCCACACAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005704.3-4013s21c1
Sequence:CCGGCCTCATGGAGGTGGAGTTTATCTCGAGATAAACTCCACCTCCATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005704.3-1342s21c1
Sequence:CCGGTGACGCGTTGCCACACCTATACTCGAGTATAGGTGTGGCAACGCGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356100    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005704.3-4890s21c1
Sequence:CCGGGTACTGGGACTTGGCATTTAGCTCGAGCTAAATGCCAAGTCCCAGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230437    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005704.3-5103s21c1
Sequence:CCGGGAACCAGGATCTGCCTATTACCTCGAGGTAATAGGCAGATCCTGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005704.3-3608s21c1
Sequence:GTACCGGCATTGATCCTCAGAGTAATTCCTCGAGGAATTACTCTGAGGATCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005704.3-3001s21c1
Sequence:CCGGCGAAGCCTGAGATGGTCTATGCTCGAGCATAGACCATCTCAGGCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005704
VALIDATED
PTPRU MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase, receptor type, U
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001847    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005704.x-5598s1c1
Sequence:CCGGACGTGCTCTCTGAATGCCAAACTCGAGTTTGGCATTCAGAGAGCACGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005704.x-4381s1c1
Sequence:CCGGCCGGAACTACAAACCCAACATCTCGAGATGTTGGGTTTGTAGTTCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005704.x-1906s1c1
Sequence:CCGGCAGCTTTGATTATGCCGACATCTCGAGATGTCGGCATAATCAAAGCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005704.x-528s1c1
Sequence:CCGGCTGTGTGGAATATGACTGGATCTCGAGATCCAGTCATATTCCACACAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005704.3-4013s21c1
Sequence:CCGGCCTCATGGAGGTGGAGTTTATCTCGAGATAAACTCCACCTCCATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005704.3-1342s21c1
Sequence:CCGGTGACGCGTTGCCACACCTATACTCGAGTATAGGTGTGGCAACGCGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356100    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005704.3-4890s21c1
Sequence:CCGGGTACTGGGACTTGGCATTTAGCTCGAGCTAAATGCCAAGTCCCAGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230437    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005704.3-5103s21c1
Sequence:CCGGGAACCAGGATCTGCCTATTACCTCGAGGTAATAGGCAGATCCTGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005704.3-3608s21c1
Sequence:GTACCGGCATTGATCCTCAGAGTAATTCCTCGAGGAATTACTCTGAGGATCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005704.3-3001s21c1
Sequence:CCGGCGAAGCCTGAGATGGTCTATGCTCGAGCATAGACCATCTCAGGCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005704
VALIDATED
PTPRU MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase, receptor type, U
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001847    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005704.x-5598s1c1
Sequence:CCGGACGTGCTCTCTGAATGCCAAACTCGAGTTTGGCATTCAGAGAGCACGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005704.x-4381s1c1
Sequence:CCGGCCGGAACTACAAACCCAACATCTCGAGATGTTGGGTTTGTAGTTCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005704.x-1906s1c1
Sequence:CCGGCAGCTTTGATTATGCCGACATCTCGAGATGTCGGCATAATCAAAGCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005704.x-528s1c1
Sequence:CCGGCTGTGTGGAATATGACTGGATCTCGAGATCCAGTCATATTCCACACAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005704.3-4013s21c1
Sequence:CCGGCCTCATGGAGGTGGAGTTTATCTCGAGATAAACTCCACCTCCATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005704.3-1342s21c1
Sequence:CCGGTGACGCGTTGCCACACCTATACTCGAGTATAGGTGTGGCAACGCGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356100    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005704.3-4890s21c1
Sequence:CCGGGTACTGGGACTTGGCATTTAGCTCGAGCTAAATGCCAAGTCCCAGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230437    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005704.3-5103s21c1
Sequence:CCGGGAACCAGGATCTGCCTATTACCTCGAGGTAATAGGCAGATCCTGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005704.3-3608s21c1
Sequence:GTACCGGCATTGATCCTCAGAGTAATTCCTCGAGGAATTACTCTGAGGATCAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005704.3-3001s21c1
Sequence:CCGGCGAAGCCTGAGATGGTCTATGCTCGAGCATAGACCATCTCAGGCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)