EMAIL THIS PAGE TO A FRIEND

PTPRVP

protein tyrosine phosphatase, receptor type, V, pseudogene

194 Gene Product Result for
Synonyms: ESP OST-PTP PTPRV
Gene ID:
chicken(421174) protein tyrosine phosphatase, receptor type, V, pseudogene
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_086287 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_086287 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_086287 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NR_002930 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_002930 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00377349 predicted 683
2 SASI_Hs02_00377350 predicted 2727
3 SASI_Hs02_00377351 predicted 692
4 SASI_Hs02_00377352 predicted 2874
5 SASI_Hs02_00377353 predicted 689
6 SASI_Hs02_00377354 predicted 1496
7 SASI_Hs02_00377355 predicted 2853
8 SASI_Hs02_00377356 predicted 1913
9 SASI_Hs02_00377357 predicted 681
10 SASI_Hs02_00377358 predicted 3064
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_086287
PTPRVP MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase, receptor type, V, pseudogene
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_086287.1-259s1c1
Sequence:CCGGCCTGAGTCGGCACTGGTCACTCTCGAGAGTGACCAGTGCCGACTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_086287.1-205s1c1
Sequence:CCGGGCAGTATATCTACCTCTACAACTCGAGTTGTAGAGGTAGATATACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_086287.1-214s1c1
Sequence:CCGGCTACCTCTACAATTGTCTGAACTCGAGTTCAGACAATTGTAGAGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_086287.1-223s1c1
Sequence:CCGGCAATTGTCTGAACAGCGCACTCTCGAGAGTGCGCTGTTCAGACAATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_086287.1-193s1c1
Sequence:CCGGCCCAACGCTGAAGCAGTATATCTCGAGATATACTGCTTCAGCGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_086287
PTPRVP MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase, receptor type, V, pseudogene
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_086287.1-259s1c1
Sequence:CCGGCCTGAGTCGGCACTGGTCACTCTCGAGAGTGACCAGTGCCGACTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_086287.1-205s1c1
Sequence:CCGGGCAGTATATCTACCTCTACAACTCGAGTTGTAGAGGTAGATATACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_086287.1-214s1c1
Sequence:CCGGCTACCTCTACAATTGTCTGAACTCGAGTTCAGACAATTGTAGAGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_086287.1-223s1c1
Sequence:CCGGCAATTGTCTGAACAGCGCACTCTCGAGAGTGCGCTGTTCAGACAATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_086287.1-193s1c1
Sequence:CCGGCCCAACGCTGAAGCAGTATATCTCGAGATATACTGCTTCAGCGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_086287
PTPRVP MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase, receptor type, V, pseudogene
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_086287.1-259s1c1
Sequence:CCGGCCTGAGTCGGCACTGGTCACTCTCGAGAGTGACCAGTGCCGACTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_086287.1-205s1c1
Sequence:CCGGGCAGTATATCTACCTCTACAACTCGAGTTGTAGAGGTAGATATACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_086287.1-214s1c1
Sequence:CCGGCTACCTCTACAATTGTCTGAACTCGAGTTCAGACAATTGTAGAGGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_086287.1-223s1c1
Sequence:CCGGCAATTGTCTGAACAGCGCACTCTCGAGAGTGCGCTGTTCAGACAATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_086287.1-193s1c1
Sequence:CCGGCCCAACGCTGAAGCAGTATATCTCGAGATATACTGCTTCAGCGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)