EMAIL THIS PAGE TO A FRIEND

PTRF

polymerase I and transcript release factor

52 Gene Product Result for
Synonyms: CAVIN CAVIN1 CGL4 cavin-1
Gene ID:
Human(284119) Summary: This gene encodes a protein that enables the dissociation of paused ternary polymerase I transcription complexes from the 3' end of pre-rRNA transcripts. This protein regulates rRNA transcription by promoting the dissociation of transcription complexes and the reinitiation of polymerase I on nascent rRNA transcripts. This protein also localizes to caveolae at the plasma membrane and is thought to play a critical role in the formation of caveolae and the stabilization of caveolins. This protein translocates from caveolae to the cytoplasm after insulin stimulation. Caveolae contain truncated forms of this protein and may be the site of phosphorylation-dependent proteolysis. This protein is also thought to modify lipid metabolism and insulin-regulated gene expression. Mutations in this gene result in a disorder characterized by generalized lipodystrophy and muscular dystrophy. [provided by RefSeq, Nov 2009]
Mouse(19285) polymerase I and transcript release factor
Rat(287710) polymerase I and transcript release factor
chicken(396006) polymerase I and transcript release factor
domestic cat(101096121) polymerase I and transcript release factor
dog(490966) polymerase I and transcript release factor
cow(538457) polymerase I and transcript release factor
sheep(101110525) polymerase I and transcript release factor
naked mole-rat(101721546) polymerase I and transcript release factor
domestic guinea pig(100717539) polymerase I and transcript release factor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012232 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012232 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012232 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008986 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008986 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008986 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012232 Rosetta Predictions human pricing
NM_001105841 Rosetta Predictions rat pricing
NM_008986 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012232 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174672 predicted 1159
2 SASI_Hs01_00174673 predicted 644
3 SASI_Hs01_00174674 predicted 1369
4 SASI_Hs01_00174675 predicted 1081
5 SASI_Hs01_00174676 predicted 508
6 SASI_Hs01_00174677 predicted 1372
7 SASI_Hs01_00174678 predicted 1557
8 SASI_Hs01_00174680 predicted 466
9 SASI_Hs01_00174681 predicted 1079
10 SASI_Hs02_00343916 predicted 1587
11 SASI_Hs01_00174679 predicted 492
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105841 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213052 predicted 1107
2 SASI_Rn02_00213053 predicted 1038
3 SASI_Rn02_00213054 predicted 300
4 SASI_Rn02_00213055 predicted 464
5 SASI_Rn02_00213056 predicted 874
6 SASI_Rn02_00213057 predicted 1068
7 SASI_Rn02_00213058 predicted 580
8 SASI_Rn02_00213059 predicted 1023
9 SASI_Rn02_00213060 predicted 703
10 SASI_Rn02_00213061 predicted 549
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008986 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182951 predicted 1752
2 SASI_Mm01_00182952 predicted 1155
3 SASI_Mm02_00315080 predicted 1784
4 SASI_Mm01_00182954 predicted 1106
5 SASI_Mm01_00182955 predicted 455
6 SASI_Mm01_00182956 predicted 1713
7 SASI_Mm01_00182957 predicted 344
8 SASI_Mm01_00182958 predicted 502
9 SASI_Mm01_00182959 predicted 596
10 SASI_Mm01_00182960 predicted 643
11 SASI_Mm01_00182953 predicted 1082
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012232
VALIDATED
PTRF MISSION shRNA Bacterial Glycerol Stock
polymerase I and transcript release factor
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012232.5-1034s21c1
Sequence:CCGGGAGAAGCGCATGAACAAGCTGCTCGAGCAGCTTGTTCATGCGCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012232.5-535s21c1
Sequence:CCGGCAATACGGTGAGCAAGCTGCTCTCGAGAGCAGCTTGCTCACCGTATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419380    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012232.5-1614s21c1
Sequence:CCGGATGGGAAGGGAATGGTCAATCCTCGAGGATTGACCATTCCCTTCCCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012232.5-1106s21c1
Sequence:CCGGGACAAGTTGCGCAAATCCTTCCTCGAGGAAGGATTTGCGCAACTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424879    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012232.5-1436s21c1
Sequence:CCGGCGAACTTCCTCTTTCGCATTCCTCGAGGAATGCGAAAGAGGAAGTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430242    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012232.5-1873s21c1
Sequence:CCGGCCTACTAGAAGGACGTGAAAGCTCGAGCTTTCACGTCCTTCTAGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012232.5-1377s21c1
Sequence:CCGGACAAGAGCGACAGCGACTGAGCTCGAGCTCAGTCGCTGTCGCTCTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012232.2-603s1c1
Sequence:CCGGCCGCAACTTTAAAGTCATGATCTCGAGATCATGACTTTAAAGTTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012232.2-778s1c1
Sequence:CCGGGTGGAGGTTGAGGAGGTTATTCTCGAGAATAACCTCCTCAACCTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012232.2-1037s1c1
Sequence:CCGGCGCGAGACAAGTTGCGCAAATCTCGAGATTTGCGCAACTTGTCTCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012232.2-912s1c1
Sequence:CCGGCCTGGAGAAGACGCGCCTCAACTCGAGTTGAGGCGCGTCTTCTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_012232.2-657s1c1
Sequence:CCGGGAGCATCAGCAAATCGCTGAACTCGAGTTCAGCGATTTGCTGATGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012232
VALIDATED
PTRF MISSION shRNA shRNA Plasmid DNA
polymerase I and transcript release factor
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012232.5-1034s21c1
Sequence:CCGGGAGAAGCGCATGAACAAGCTGCTCGAGCAGCTTGTTCATGCGCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012232.5-535s21c1
Sequence:CCGGCAATACGGTGAGCAAGCTGCTCTCGAGAGCAGCTTGCTCACCGTATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419380    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012232.5-1614s21c1
Sequence:CCGGATGGGAAGGGAATGGTCAATCCTCGAGGATTGACCATTCCCTTCCCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012232.5-1106s21c1
Sequence:CCGGGACAAGTTGCGCAAATCCTTCCTCGAGGAAGGATTTGCGCAACTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424879    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012232.5-1436s21c1
Sequence:CCGGCGAACTTCCTCTTTCGCATTCCTCGAGGAATGCGAAAGAGGAAGTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430242    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012232.5-1873s21c1
Sequence:CCGGCCTACTAGAAGGACGTGAAAGCTCGAGCTTTCACGTCCTTCTAGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012232.5-1377s21c1
Sequence:CCGGACAAGAGCGACAGCGACTGAGCTCGAGCTCAGTCGCTGTCGCTCTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012232.2-603s1c1
Sequence:CCGGCCGCAACTTTAAAGTCATGATCTCGAGATCATGACTTTAAAGTTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012232.2-778s1c1
Sequence:CCGGGTGGAGGTTGAGGAGGTTATTCTCGAGAATAACCTCCTCAACCTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012232.2-1037s1c1
Sequence:CCGGCGCGAGACAAGTTGCGCAAATCTCGAGATTTGCGCAACTTGTCTCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012232.2-912s1c1
Sequence:CCGGCCTGGAGAAGACGCGCCTCAACTCGAGTTGAGGCGCGTCTTCTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_012232.2-657s1c1
Sequence:CCGGGAGCATCAGCAAATCGCTGAACTCGAGTTCAGCGATTTGCTGATGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012232
VALIDATED
PTRF MISSION shRNA Lentiviral Transduction Particles
polymerase I and transcript release factor
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012232.5-1034s21c1
Sequence:CCGGGAGAAGCGCATGAACAAGCTGCTCGAGCAGCTTGTTCATGCGCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012232.5-535s21c1
Sequence:CCGGCAATACGGTGAGCAAGCTGCTCTCGAGAGCAGCTTGCTCACCGTATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419380    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012232.5-1614s21c1
Sequence:CCGGATGGGAAGGGAATGGTCAATCCTCGAGGATTGACCATTCCCTTCCCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012232.5-1106s21c1
Sequence:CCGGGACAAGTTGCGCAAATCCTTCCTCGAGGAAGGATTTGCGCAACTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424879    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012232.5-1436s21c1
Sequence:CCGGCGAACTTCCTCTTTCGCATTCCTCGAGGAATGCGAAAGAGGAAGTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430242    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012232.5-1873s21c1
Sequence:CCGGCCTACTAGAAGGACGTGAAAGCTCGAGCTTTCACGTCCTTCTAGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012232.5-1377s21c1
Sequence:CCGGACAAGAGCGACAGCGACTGAGCTCGAGCTCAGTCGCTGTCGCTCTTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012232.2-603s1c1
Sequence:CCGGCCGCAACTTTAAAGTCATGATCTCGAGATCATGACTTTAAAGTTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012232.2-778s1c1
Sequence:CCGGGTGGAGGTTGAGGAGGTTATTCTCGAGAATAACCTCCTCAACCTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012232.2-1037s1c1
Sequence:CCGGCGCGAGACAAGTTGCGCAAATCTCGAGATTTGCGCAACTTGTCTCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012232.2-912s1c1
Sequence:CCGGCCTGGAGAAGACGCGCCTCAACTCGAGTTGAGGCGCGTCTTCTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_012232.2-657s1c1
Sequence:CCGGGAGCATCAGCAAATCGCTGAACTCGAGTTCAGCGATTTGCTGATGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008986
VALIDATED
PTRF MISSION shRNA Bacterial Glycerol Stock
polymerase I and transcript release factor
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000306023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008986.2-190s21c1
Sequence:CCGGTTCCGGATTTCCCGATGCTTCCTCGAGGAAGCATCGGGAAATCCGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306092    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008986.2-1759s21c1
Sequence:CCGGGAGACTCCAAAGCCCAAATTTCTCGAGAAATTTGGGCTTTGGAGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008986.2-603s21c1
Sequence:CCGGGCAACTTCAAAGTCATGATCTCTCGAGAGATCATGACTTTGAAGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008986.2-504s21c1
Sequence:CCGGAGGTCAGCGTCAACGTGAAGACTCGAGTCTTCACGTTGACGCTGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008986.2-1114s21c1
Sequence:CCGGGCCTTTCACCTTCCACGTCAACTCGAGTTGACGTGGAAGGTGAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008986.2-656s1c1
Sequence:CCGGAGCGTCAGCAAGTCGCTGAAACTCGAGTTTCAGCGACTTGCTGACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008986.2-1114s1c1
Sequence:CCGGGCCTTTCACCTTCCACGTCAACTCGAGTTGACGTGGAAGGTGAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008986.2-559s1c1
Sequence:CCGGGATAAAGAAACTGGAGGTCAACTCGAGTTGACCTCCAGTTTCTTTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103575    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008986.2-2123s1c1
Sequence:CCGGGCAGAGTGTTTGGTGGATAAACTCGAGTTTATCCACCAAACACTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008986.2-1084s1c1
Sequence:CCGGGCGCTCCAAGACCGCTGTCTACTCGAGTAGACAGCGGTCTTGGAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008986
VALIDATED
PTRF MISSION shRNA shRNA Plasmid DNA
polymerase I and transcript release factor
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000306023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008986.2-190s21c1
Sequence:CCGGTTCCGGATTTCCCGATGCTTCCTCGAGGAAGCATCGGGAAATCCGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306092    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008986.2-1759s21c1
Sequence:CCGGGAGACTCCAAAGCCCAAATTTCTCGAGAAATTTGGGCTTTGGAGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008986.2-603s21c1
Sequence:CCGGGCAACTTCAAAGTCATGATCTCTCGAGAGATCATGACTTTGAAGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008986.2-504s21c1
Sequence:CCGGAGGTCAGCGTCAACGTGAAGACTCGAGTCTTCACGTTGACGCTGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008986.2-1114s21c1
Sequence:CCGGGCCTTTCACCTTCCACGTCAACTCGAGTTGACGTGGAAGGTGAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008986.2-656s1c1
Sequence:CCGGAGCGTCAGCAAGTCGCTGAAACTCGAGTTTCAGCGACTTGCTGACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008986.2-1114s1c1
Sequence:CCGGGCCTTTCACCTTCCACGTCAACTCGAGTTGACGTGGAAGGTGAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008986.2-559s1c1
Sequence:CCGGGATAAAGAAACTGGAGGTCAACTCGAGTTGACCTCCAGTTTCTTTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103575    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008986.2-2123s1c1
Sequence:CCGGGCAGAGTGTTTGGTGGATAAACTCGAGTTTATCCACCAAACACTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008986.2-1084s1c1
Sequence:CCGGGCGCTCCAAGACCGCTGTCTACTCGAGTAGACAGCGGTCTTGGAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008986
VALIDATED
PTRF MISSION shRNA Lentiviral Transduction Particles
polymerase I and transcript release factor
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000306023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008986.2-190s21c1
Sequence:CCGGTTCCGGATTTCCCGATGCTTCCTCGAGGAAGCATCGGGAAATCCGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306092    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008986.2-1759s21c1
Sequence:CCGGGAGACTCCAAAGCCCAAATTTCTCGAGAAATTTGGGCTTTGGAGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008986.2-603s21c1
Sequence:CCGGGCAACTTCAAAGTCATGATCTCTCGAGAGATCATGACTTTGAAGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008986.2-504s21c1
Sequence:CCGGAGGTCAGCGTCAACGTGAAGACTCGAGTCTTCACGTTGACGCTGACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008986.2-1114s21c1
Sequence:CCGGGCCTTTCACCTTCCACGTCAACTCGAGTTGACGTGGAAGGTGAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008986.2-656s1c1
Sequence:CCGGAGCGTCAGCAAGTCGCTGAAACTCGAGTTTCAGCGACTTGCTGACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008986.2-1114s1c1
Sequence:CCGGGCCTTTCACCTTCCACGTCAACTCGAGTTGACGTGGAAGGTGAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008986.2-559s1c1
Sequence:CCGGGATAAAGAAACTGGAGGTCAACTCGAGTTGACCTCCAGTTTCTTTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103575    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008986.2-2123s1c1
Sequence:CCGGGCAGAGTGTTTGGTGGATAAACTCGAGTTTATCCACCAAACACTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008986.2-1084s1c1
Sequence:CCGGGCGCTCCAAGACCGCTGTCTACTCGAGTAGACAGCGGTCTTGGAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)