EMAIL THIS PAGE TO A FRIEND

PTRH1

peptidyl-tRNA hydrolase 1 homolog (S. cerevisiae)

109 Gene Product Result for
Synonyms: C9orf115 PTH1
UniProtKB ID: Q86Y79
Gene ID:
Mouse(329384) peptidyl-tRNA hydrolase 1 homolog (S. cerevisiae)
Rat(362113) peptidyl-tRNA hydrolase 1 homolog (S. cerevisiae)
Zebrafish(503752) peptidyl-tRNA hydrolase 1 homolog (S. cerevisiae)
dog(480713) peptidyl-tRNA hydrolase 1 homolog (S. cerevisiae)
domestic cat(101097280) peptidyl-tRNA hydrolase 1 homolog (S. cerevisiae)
domestic guinea pig(100726559) peptidyl-tRNA hydrolase 1 homolog (S. cerevisiae)
naked mole-rat(101725403) peptidyl-tRNA hydrolase 1 homolog (S. cerevisiae)
cow(505680) peptidyl-tRNA hydrolase 1 homolog (S. cerevisiae)
sheep(101110047) peptidyl-tRNA hydrolase 1 homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001002913 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001002913 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001002913 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178595 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178595 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178595 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU072161 MISSION® esiRNA esiRNA targeting mouse Ptrh1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002913 Rosetta Predictions human pricing
NM_001108580 Rosetta Predictions rat pricing
NM_178595 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002913 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080937 predicted 288
2 SASI_Hs01_00080938 predicted 460
3 SASI_Hs01_00080940 predicted 427
4 SASI_Hs01_00080941 predicted 217
5 SASI_Hs01_00080942 predicted 323
6 SASI_Hs01_00080944 predicted 441
7 SASI_Hs01_00080945 predicted 450
8 SASI_Hs02_00304260 predicted 283
9 SASI_Hs02_00304261 predicted 276
10 SASI_Hs02_00304262 predicted 209
11 SASI_Hs01_00080939 predicted 359
12 SASI_Hs01_00080943 predicted 281
13 SASI_Hs01_00080946 predicted 492
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108580 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240039 predicted 860
2 SASI_Rn02_00240040 predicted 975
3 SASI_Rn02_00240041 predicted 1025
4 SASI_Rn02_00240042 predicted 270
5 SASI_Rn02_00240043 predicted 735
6 SASI_Rn02_00240044 predicted 225
7 SASI_Rn02_00240045 predicted 870
8 SASI_Rn02_00240046 predicted 562
9 SASI_Rn02_00240047 predicted 631
10 SASI_Rn02_00240048 predicted 720
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178595 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103224 predicted 390
2 SASI_Mm01_00103225 predicted 598
3 SASI_Mm01_00103226 predicted 338
4 SASI_Mm01_00103227 predicted 408
5 SASI_Mm01_00103228 predicted 416
6 SASI_Mm01_00103230 predicted 312
7 SASI_Mm01_00103231 predicted 599
8 SASI_Mm02_00348920 predicted 611
9 SASI_Mm01_00103232 predicted 467
10 SASI_Mm01_00103233 predicted 414
11 SASI_Mm01_00103229 predicted 672
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001002913
PTRH1 MISSION shRNA Bacterial Glycerol Stock
peptidyl-tRNA hydrolase 1 homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002913.1-358s1c1
Sequence:CCGGGAGGAAGTCTACCTGGTGCATCTCGAGATGCACCAGGTAGACTTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002913.1-606s1c1
Sequence:CCGGCGACCTGATCTTGGACCACATCTCGAGATGTGGTCCAAGATCAGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002913.1-465s1c1
Sequence:CCGGCTGCCTCAACTCCAATGCAATCTCGAGATTGCATTGGAGTTGAGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002913.1-61s1c1
Sequence:CCGGAGAGCCATGAGCCGATGTGTTCTCGAGAACACATCGGCTCATGGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002913.1-682s1c1
Sequence:CCGGCCTGCCTGACTGTAGTGCCCACTCGAGTGGGCACTACAGTCAGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002913.1-468s21c1
Sequence:CCGGCCTCAACTCCAATGCAATGCCCTCGAGGGCATTGCATTGGAGTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002913.1-58s21c1
Sequence:CCGGAGTAGAGCCATGAGCCGATGTCTCGAGACATCGGCTCATGGCTCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002913.1-444s21c1
Sequence:CCGGTGGAGTCCGTTCCTGCATTAGCTCGAGCTAATGCAGGAACGGACTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002913.1-363s21c1
Sequence:CCGGAGTCTACCTGGTGCATGATGACTCGAGTCATCATGCACCAGGTAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002913.1-606s21c1
Sequence:CCGGCGACCTGATCTTGGACCACATCTCGAGATGTGGTCCAAGATCAGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001002913
PTRH1 MISSION shRNA shRNA Plasmid DNA
peptidyl-tRNA hydrolase 1 homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002913.1-358s1c1
Sequence:CCGGGAGGAAGTCTACCTGGTGCATCTCGAGATGCACCAGGTAGACTTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002913.1-606s1c1
Sequence:CCGGCGACCTGATCTTGGACCACATCTCGAGATGTGGTCCAAGATCAGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002913.1-465s1c1
Sequence:CCGGCTGCCTCAACTCCAATGCAATCTCGAGATTGCATTGGAGTTGAGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002913.1-61s1c1
Sequence:CCGGAGAGCCATGAGCCGATGTGTTCTCGAGAACACATCGGCTCATGGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002913.1-682s1c1
Sequence:CCGGCCTGCCTGACTGTAGTGCCCACTCGAGTGGGCACTACAGTCAGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002913.1-468s21c1
Sequence:CCGGCCTCAACTCCAATGCAATGCCCTCGAGGGCATTGCATTGGAGTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002913.1-58s21c1
Sequence:CCGGAGTAGAGCCATGAGCCGATGTCTCGAGACATCGGCTCATGGCTCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002913.1-444s21c1
Sequence:CCGGTGGAGTCCGTTCCTGCATTAGCTCGAGCTAATGCAGGAACGGACTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002913.1-363s21c1
Sequence:CCGGAGTCTACCTGGTGCATGATGACTCGAGTCATCATGCACCAGGTAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002913.1-606s21c1
Sequence:CCGGCGACCTGATCTTGGACCACATCTCGAGATGTGGTCCAAGATCAGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001002913
PTRH1 MISSION shRNA Lentiviral Transduction Particles
peptidyl-tRNA hydrolase 1 homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002913.1-358s1c1
Sequence:CCGGGAGGAAGTCTACCTGGTGCATCTCGAGATGCACCAGGTAGACTTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002913.1-606s1c1
Sequence:CCGGCGACCTGATCTTGGACCACATCTCGAGATGTGGTCCAAGATCAGGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002913.1-465s1c1
Sequence:CCGGCTGCCTCAACTCCAATGCAATCTCGAGATTGCATTGGAGTTGAGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002913.1-61s1c1
Sequence:CCGGAGAGCCATGAGCCGATGTGTTCTCGAGAACACATCGGCTCATGGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002913.1-682s1c1
Sequence:CCGGCCTGCCTGACTGTAGTGCCCACTCGAGTGGGCACTACAGTCAGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002913.1-468s21c1
Sequence:CCGGCCTCAACTCCAATGCAATGCCCTCGAGGGCATTGCATTGGAGTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002913.1-58s21c1
Sequence:CCGGAGTAGAGCCATGAGCCGATGTCTCGAGACATCGGCTCATGGCTCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002913.1-444s21c1
Sequence:CCGGTGGAGTCCGTTCCTGCATTAGCTCGAGCTAATGCAGGAACGGACTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002913.1-363s21c1
Sequence:CCGGAGTCTACCTGGTGCATGATGACTCGAGTCATCATGCACCAGGTAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002913.1-606s21c1
Sequence:CCGGCGACCTGATCTTGGACCACATCTCGAGATGTGGTCCAAGATCAGGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178595
VALIDATED
PTRH1 MISSION shRNA Bacterial Glycerol Stock
peptidyl-tRNA hydrolase 1 homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178595.3-683s21c1
Sequence:CCGGGCCACAGAACTGCAATGACACCTCGAGGTGTCATTGCAGTTCTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_178595.3-168s21c1
Sequence:CCGGGGAGAATTGGACTCGTGACTCCTCGAGGAGTCACGAGTCCAATTCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_178595.3-619s21c1
Sequence:CCGGCTCTAATACCAGTGGATATATCTCGAGATATATCCACTGGTATTAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178595.3-405s21c1
Sequence:CCGGTGGAGTCCGTTCCTGCATTAGCTCGAGCTAATGCAGGAACGGACTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_178595.3-312s21c1
Sequence:CCGGGACTGCGGAGGAGATCTATCTCTCGAGAGATAGATCTCCTCCGCAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178595
VALIDATED
PTRH1 MISSION shRNA shRNA Plasmid DNA
peptidyl-tRNA hydrolase 1 homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178595.3-683s21c1
Sequence:CCGGGCCACAGAACTGCAATGACACCTCGAGGTGTCATTGCAGTTCTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_178595.3-168s21c1
Sequence:CCGGGGAGAATTGGACTCGTGACTCCTCGAGGAGTCACGAGTCCAATTCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_178595.3-619s21c1
Sequence:CCGGCTCTAATACCAGTGGATATATCTCGAGATATATCCACTGGTATTAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178595.3-405s21c1
Sequence:CCGGTGGAGTCCGTTCCTGCATTAGCTCGAGCTAATGCAGGAACGGACTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_178595.3-312s21c1
Sequence:CCGGGACTGCGGAGGAGATCTATCTCTCGAGAGATAGATCTCCTCCGCAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178595
VALIDATED
PTRH1 MISSION shRNA Lentiviral Transduction Particles
peptidyl-tRNA hydrolase 1 homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178595.3-683s21c1
Sequence:CCGGGCCACAGAACTGCAATGACACCTCGAGGTGTCATTGCAGTTCTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_178595.3-168s21c1
Sequence:CCGGGGAGAATTGGACTCGTGACTCCTCGAGGAGTCACGAGTCCAATTCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_178595.3-619s21c1
Sequence:CCGGCTCTAATACCAGTGGATATATCTCGAGATATATCCACTGGTATTAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178595.3-405s21c1
Sequence:CCGGTGGAGTCCGTTCCTGCATTAGCTCGAGCTAATGCAGGAACGGACTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_178595.3-312s21c1
Sequence:CCGGGACTGCGGAGGAGATCTATCTCTCGAGAGATAGATCTCCTCCGCAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)