EMAIL THIS PAGE TO A FRIEND

PTRH2

peptidyl-tRNA hydrolase 2

71 Gene Product Result for
Synonyms: BIT1 PTH2
UniProtKB ID: Q9Y3E5, B3KUY4, Q9NTE5
Gene ID:
Mouse(217057) peptidyl-tRNA hydrolase 2
Rat(287593) peptidyl-tRNA hydrolase 2
cow(516595) peptidyl-tRNA hydrolase 2
sheep(101105169) peptidyl-tRNA hydrolase 2
naked mole-rat(101721126) peptidyl-tRNA hydrolase 2
domestic guinea pig(100722628) peptidyl-tRNA hydrolase 2
Zebrafish(791795) peptidyl-tRNA hydrolase 2
domestic cat(101093219) peptidyl-tRNA hydrolase 2
dog(100682594) peptidyl-tRNA hydrolase 2
chicken(417634) peptidyl-tRNA hydrolase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175004 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175004 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175004 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016077 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016077 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016077 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001015509 Rosetta Predictions human pricing
NM_016077 Rosetta Predictions human pricing
NM_001013860 Rosetta Predictions rat pricing
NM_001098810 Rosetta Predictions mouse pricing
NM_175004 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001015509 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160545 predicted 1651
2 SASI_Hs01_00160546 predicted 1719
3 SASI_Hs01_00160547 predicted 1700
4 SASI_Hs01_00160548 predicted 1849
5 SASI_Hs01_00160549 predicted 1821
6 SASI_Hs01_00160550 predicted 1716
7 SASI_Hs01_00160551 predicted 1890
8 SASI_Hs01_00160552 predicted 1855
9 SASI_Hs01_00160553 predicted 1752
10 SASI_Hs01_00160554 predicted 1881
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016077 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098034 predicted 373
2 SASI_Hs02_00348822 predicted 470
3 SASI_Hs01_00098035 predicted 527
4 SASI_Hs01_00098036 predicted 497
5 SASI_Hs01_00098037 predicted 395
6 SASI_Hs01_00098040 predicted 527
7 SASI_Hs01_00098041 predicted 430
8 SASI_Hs02_00348823 predicted 557
9 SASI_Hs02_00348824 predicted 325
10 SASI_Hs02_00348825 predicted 504
11 SASI_Hs01_00098032 predicted 337
12 SASI_Hs01_00098033 predicted 400
13 SASI_Hs01_00098038 predicted 537
14 SASI_Hs01_00098039 predicted 574
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013860 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064556 predicted 673
2 SASI_Rn02_00201126 predicted 305
3 SASI_Rn01_00064553 predicted 446
4 SASI_Rn01_00064554 predicted 527
5 SASI_Rn01_00064555 predicted 617
6 SASI_Rn01_00064557 predicted 536
7 SASI_Rn01_00064558 predicted 448
8 SASI_Rn01_00064559 predicted 438
9 SASI_Rn02_00201127 predicted 692
10 SASI_Rn01_00064560 predicted 415
11 SASI_Rn01_00064552 predicted 394
12 SASI_Rn01_00064561 predicted 346
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098810 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00301461 predicted 681
2 SASI_Mm02_00301462 predicted 458
3 SASI_Mm02_00301463 predicted 393
4 SASI_Mm02_00301464 predicted 696
5 SASI_Mm02_00301465 predicted 745
6 SASI_Mm02_00301466 predicted 702
7 SASI_Mm02_00301467 predicted 373
8 SASI_Mm02_00301468 predicted 812
9 SASI_Mm02_00301469 predicted 677
10 SASI_Mm02_00301470 predicted 637
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175004 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345561 predicted 874
2 SASI_Mm02_00345562 predicted 654
3 SASI_Mm02_00345563 predicted 587
4 SASI_Mm02_00345564 predicted 885
5 SASI_Mm02_00345565 predicted 931
6 SASI_Mm02_00345566 predicted 892
7 SASI_Mm02_00345567 predicted 558
8 SASI_Mm02_00345568 predicted 1000
9 SASI_Mm02_00345569 predicted 867
10 SASI_Mm02_00345570 predicted 828
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175004
PTRH2 MISSION shRNA Bacterial Glycerol Stock
peptidyl-tRNA hydrolase 2
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175004.2-517s21c1
Sequence:CCGGGCCTACAAGCAGACTCAAAGGCTCGAGCCTTTGAGTCTGCTTGTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175004.1-676s1c1
Sequence:CCGGGCTGGACGTACTCAGATTGAACTCGAGTTCAATCTGAGTACGTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175004.1-615s1c1
Sequence:CCGGCCTCATTCAATTACTCACCCACTCGAGTGGGTGAGTAATTGAATGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192661    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175004.1-2764s1c1
Sequence:CCGGGCTGGGCAATAAGAAGTCTTTCTCGAGAAAGACTTCTTATTGCCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175004.2-267s21c1
Sequence:CCGGGGTTCATCCTGGTACACTCAGCTCGAGCTGAGTGTACCAGGATGAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423619    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175004.2-846s21c1
Sequence:CCGGTAATTCTTGTCCCACTTTAAACTCGAGTTTAAAGTGGGACAAGAATTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175004.2-705s21c1
Sequence:CCGGTCGAACTGTCCTGGGAATTGGCTCGAGCCAATTCCCAGGACAGTTCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421336    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175004.2-1250s21c1
Sequence:CCGGGCGTTTCCCAGGTACAGTTAGCTCGAGCTAACTGTACCTGGGAAACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175004.2-539s21c1
Sequence:CCGGGAAGCCCTCAAGTGCTCAAAGCTCGAGCTTTGAGCACTTGAGGGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175004.1-733s1c1
Sequence:CCGGCCAGTAGAACTAATTGATGAACTCGAGTTCATCAATTAGTTCTACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175004.2-647s21c1
Sequence:CCGGTGGGACTGACTGTAAGTTTAACTCGAGTTAAACTTACAGTCAGTCCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175004.2-578s21c1
Sequence:CCGGAGCCCAAAGTGGTGGTCAAAGCTCGAGCTTTGACCACCACTTTGGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175004.1-601s1c1
Sequence:CCGGCCAGATGAAGACACCCTCATTCTCGAGAATGAGGGTGTCTTCATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190127    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175004.1-1801s1c1
Sequence:CCGGCCAGCCAGTTTCTCCTAGAAACTCGAGTTTCTAGGAGAAACTGGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175004
PTRH2 MISSION shRNA shRNA Plasmid DNA
peptidyl-tRNA hydrolase 2
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175004.2-517s21c1
Sequence:CCGGGCCTACAAGCAGACTCAAAGGCTCGAGCCTTTGAGTCTGCTTGTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175004.1-676s1c1
Sequence:CCGGGCTGGACGTACTCAGATTGAACTCGAGTTCAATCTGAGTACGTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175004.1-615s1c1
Sequence:CCGGCCTCATTCAATTACTCACCCACTCGAGTGGGTGAGTAATTGAATGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192661    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175004.1-2764s1c1
Sequence:CCGGGCTGGGCAATAAGAAGTCTTTCTCGAGAAAGACTTCTTATTGCCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175004.2-267s21c1
Sequence:CCGGGGTTCATCCTGGTACACTCAGCTCGAGCTGAGTGTACCAGGATGAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423619    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175004.2-846s21c1
Sequence:CCGGTAATTCTTGTCCCACTTTAAACTCGAGTTTAAAGTGGGACAAGAATTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175004.2-705s21c1
Sequence:CCGGTCGAACTGTCCTGGGAATTGGCTCGAGCCAATTCCCAGGACAGTTCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421336    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175004.2-1250s21c1
Sequence:CCGGGCGTTTCCCAGGTACAGTTAGCTCGAGCTAACTGTACCTGGGAAACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175004.2-539s21c1
Sequence:CCGGGAAGCCCTCAAGTGCTCAAAGCTCGAGCTTTGAGCACTTGAGGGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175004.1-733s1c1
Sequence:CCGGCCAGTAGAACTAATTGATGAACTCGAGTTCATCAATTAGTTCTACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175004.2-647s21c1
Sequence:CCGGTGGGACTGACTGTAAGTTTAACTCGAGTTAAACTTACAGTCAGTCCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175004.2-578s21c1
Sequence:CCGGAGCCCAAAGTGGTGGTCAAAGCTCGAGCTTTGACCACCACTTTGGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175004.1-601s1c1
Sequence:CCGGCCAGATGAAGACACCCTCATTCTCGAGAATGAGGGTGTCTTCATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190127    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175004.1-1801s1c1
Sequence:CCGGCCAGCCAGTTTCTCCTAGAAACTCGAGTTTCTAGGAGAAACTGGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175004
PTRH2 MISSION shRNA Lentiviral Transduction Particles
peptidyl-tRNA hydrolase 2
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175004.2-517s21c1
Sequence:CCGGGCCTACAAGCAGACTCAAAGGCTCGAGCCTTTGAGTCTGCTTGTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175004.1-676s1c1
Sequence:CCGGGCTGGACGTACTCAGATTGAACTCGAGTTCAATCTGAGTACGTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175004.1-615s1c1
Sequence:CCGGCCTCATTCAATTACTCACCCACTCGAGTGGGTGAGTAATTGAATGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192661    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175004.1-2764s1c1
Sequence:CCGGGCTGGGCAATAAGAAGTCTTTCTCGAGAAAGACTTCTTATTGCCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175004.2-267s21c1
Sequence:CCGGGGTTCATCCTGGTACACTCAGCTCGAGCTGAGTGTACCAGGATGAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423619    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175004.2-846s21c1
Sequence:CCGGTAATTCTTGTCCCACTTTAAACTCGAGTTTAAAGTGGGACAAGAATTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175004.2-705s21c1
Sequence:CCGGTCGAACTGTCCTGGGAATTGGCTCGAGCCAATTCCCAGGACAGTTCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421336    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175004.2-1250s21c1
Sequence:CCGGGCGTTTCCCAGGTACAGTTAGCTCGAGCTAACTGTACCTGGGAAACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175004.2-539s21c1
Sequence:CCGGGAAGCCCTCAAGTGCTCAAAGCTCGAGCTTTGAGCACTTGAGGGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175004.1-733s1c1
Sequence:CCGGCCAGTAGAACTAATTGATGAACTCGAGTTCATCAATTAGTTCTACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175004.2-647s21c1
Sequence:CCGGTGGGACTGACTGTAAGTTTAACTCGAGTTAAACTTACAGTCAGTCCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175004.2-578s21c1
Sequence:CCGGAGCCCAAAGTGGTGGTCAAAGCTCGAGCTTTGACCACCACTTTGGGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175004.1-601s1c1
Sequence:CCGGCCAGATGAAGACACCCTCATTCTCGAGAATGAGGGTGTCTTCATCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190127    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175004.1-1801s1c1
Sequence:CCGGCCAGCCAGTTTCTCCTAGAAACTCGAGTTTCTAGGAGAAACTGGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016077
VALIDATED
PTRH2 MISSION shRNA Bacterial Glycerol Stock
peptidyl-tRNA hydrolase 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000296012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_016077.3-424s21c1
Sequence:CCGGGAAATCCTGAAATGCTCAAACCTCGAGGTTTGAGCATTTCAGGATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_016077.3-401s21c1
Sequence:CCGGAGCCTACAAGCAGATTCAAAGCTCGAGCTTTGAATCTGCTTGTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016077.3-612s21c1
Sequence:CCGGCCAGGACCAGCAGACCTAATTCTCGAGAATTAGGTCTGCTGGTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_016077.3-270s21c1
Sequence:CCGGCACACAGATACTGAAAGTGAACTCGAGTTCACTTTCAGTATCTGTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_016077.1-488s1c1
Sequence:CCGGCCTGATGAAGAAACCCTGATTCTCGAGAATCAGGGTTTCTTCATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016077.1-223s1c1
Sequence:CCGGCCTTCGAGTATGCTTTGGGATCTCGAGATCCCAAAGCATACTCGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_016077.1-272s1c1
Sequence:CCGGCACACAGATACTGAAAGTGAACTCGAGTTCACTTTCAGTATCTGTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016077.1-636s1c1
Sequence:CCGGACAAAGTCACTGGTCACCTAACTCGAGTTAGGTGACCAGTGACTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_016077.3-324s21c1
Sequence:CCGGATGATTCTTGTGGTTCGAAATCTCGAGATTTCGAACCACAAGAATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_016077.1-532s1c1
Sequence:CCGGGCTGGGACTGACTGTAAGTTTCTCGAGAAACTTACAGTCAGTCCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016077
VALIDATED
PTRH2 MISSION shRNA shRNA Plasmid DNA
peptidyl-tRNA hydrolase 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000296012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_016077.3-424s21c1
Sequence:CCGGGAAATCCTGAAATGCTCAAACCTCGAGGTTTGAGCATTTCAGGATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_016077.3-401s21c1
Sequence:CCGGAGCCTACAAGCAGATTCAAAGCTCGAGCTTTGAATCTGCTTGTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016077.3-612s21c1
Sequence:CCGGCCAGGACCAGCAGACCTAATTCTCGAGAATTAGGTCTGCTGGTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_016077.3-270s21c1
Sequence:CCGGCACACAGATACTGAAAGTGAACTCGAGTTCACTTTCAGTATCTGTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_016077.1-488s1c1
Sequence:CCGGCCTGATGAAGAAACCCTGATTCTCGAGAATCAGGGTTTCTTCATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016077.1-223s1c1
Sequence:CCGGCCTTCGAGTATGCTTTGGGATCTCGAGATCCCAAAGCATACTCGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_016077.1-272s1c1
Sequence:CCGGCACACAGATACTGAAAGTGAACTCGAGTTCACTTTCAGTATCTGTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016077.1-636s1c1
Sequence:CCGGACAAAGTCACTGGTCACCTAACTCGAGTTAGGTGACCAGTGACTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_016077.3-324s21c1
Sequence:CCGGATGATTCTTGTGGTTCGAAATCTCGAGATTTCGAACCACAAGAATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_016077.1-532s1c1
Sequence:CCGGGCTGGGACTGACTGTAAGTTTCTCGAGAAACTTACAGTCAGTCCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016077
VALIDATED
PTRH2 MISSION shRNA Lentiviral Transduction Particles
peptidyl-tRNA hydrolase 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000296012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_016077.3-424s21c1
Sequence:CCGGGAAATCCTGAAATGCTCAAACCTCGAGGTTTGAGCATTTCAGGATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_016077.3-401s21c1
Sequence:CCGGAGCCTACAAGCAGATTCAAAGCTCGAGCTTTGAATCTGCTTGTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016077.3-612s21c1
Sequence:CCGGCCAGGACCAGCAGACCTAATTCTCGAGAATTAGGTCTGCTGGTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_016077.3-270s21c1
Sequence:CCGGCACACAGATACTGAAAGTGAACTCGAGTTCACTTTCAGTATCTGTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_016077.1-488s1c1
Sequence:CCGGCCTGATGAAGAAACCCTGATTCTCGAGAATCAGGGTTTCTTCATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016077.1-223s1c1
Sequence:CCGGCCTTCGAGTATGCTTTGGGATCTCGAGATCCCAAAGCATACTCGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_016077.1-272s1c1
Sequence:CCGGCACACAGATACTGAAAGTGAACTCGAGTTCACTTTCAGTATCTGTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016077.1-636s1c1
Sequence:CCGGACAAAGTCACTGGTCACCTAACTCGAGTTAGGTGACCAGTGACTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_016077.3-324s21c1
Sequence:CCGGATGATTCTTGTGGTTCGAAATCTCGAGATTTCGAACCACAAGAATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_016077.1-532s1c1
Sequence:CCGGGCTGGGACTGACTGTAAGTTTCTCGAGAAACTTACAGTCAGTCCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)