EMAIL THIS PAGE TO A FRIEND

PTTG1

pituitary tumor-transforming 1

69 Gene Product Result for
Synonyms: EAP1 HPTTG PTTG TUTR1
UniProtKB ID: O95997
Gene ID:
Human(9232) Summary: The encoded protein is a homolog of yeast securin proteins, which prevent separins from promoting sister chromatid separation. It is an anaphase-promoting complex (APC) substrate that associates with a separin until activation of the APC. The gene product has transforming activity in vitro and tumorigenic activity in vivo, and the gene is highly expressed in various tumors. The gene product contains 2 PXXP motifs, which are required for its transforming and tumorigenic activities, as well as for its stimulation of basic fibroblast growth factor expression. It also contains a destruction box (D box) that is required for its degradation by the APC. The acidic C-terminal region of the encoded protein can act as a transactivation domain. The gene product is mainly a cytosolic protein, although it partially localizes in the nucleus. [provided by RefSeq, Jul 2008]
Mouse(30939) pituitary tumor-transforming gene 1
Rat(64193) pituitary tumor-transforming 1
Zebrafish(100307086) pituitary tumor-transforming 1
chicken(416158) pituitary tumor-transforming 1
dog(479307) pituitary tumor-transforming 1
domestic cat(101084421) pituitary tumor-transforming 1
domestic guinea pig(100717950) pituitary tumor-transforming 1
naked mole-rat(101723041) pituitary tumor-transforming 1
cow(508043) pituitary tumor-transforming 1
sheep(101116829) pituitary tumor-transforming 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1409992 Anti-PTTG1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
AV38424 Anti-PTTG1 antibody produced in rabbit IgG fraction of antiserum, lyophilized powder mouse, canine, pig, human, bovine
western blot pricing
SAB1411630 Anti-PTTG1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA045034 Anti-PTTG1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2104466 Anti-PTTG1, (N-terminal) antibody produced in rabbit affinity isolated antibody, lyophilized powder human, mouse
western blot pricing
WH0009232M1 Monoclonal Anti-PTTG1 antibody produced in mouse clone 1D9, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409988 Monoclonal Anti-PTTG1 antibody produced in mouse clone 3F9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence pricing
SAB1409989 Monoclonal Anti-PTTG1 antibody produced in mouse clone 1G10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence pricing
SAB1409990 Monoclonal Anti-PTTG1 antibody produced in mouse clone 3H8, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409991 Monoclonal Anti-PTTG1 antibody produced in mouse clone 4E5, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1404689 Monoclonal Anti-PTTG1, (N-terminal) antibody produced in mouse clone 2C3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013917 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013917 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013917 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004219 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004219 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004219 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004219 Rosetta Predictions human pricing
NM_022391 Rosetta Predictions rat pricing
NM_001131054 Rosetta Predictions mouse pricing
NM_013917 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004219 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00337129 predicted 254
2 SASI_Hs02_00337130 predicted 634
3 SASI_Hs02_00337131 predicted 656
4 SASI_Hs02_00337132 predicted 673
5 SASI_Hs01_00243145 predicted 326
6 SASI_Hs01_00243146 predicted 370
7 SASI_Hs01_00243147 predicted 226
8 SASI_Hs01_00243148 predicted 475
9 SASI_Hs01_00243149 predicted 209
10 SASI_Hs01_00243150 predicted 235
11 SASI_Hs01_00243151 predicted 201
12 SASI_Hs01_00243152 predicted 203
13 SASI_Hs01_00243153 predicted 432
14 SASI_Hs01_00243154 predicted 359
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022391 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115203 predicted 280
2 SASI_Rn01_00115204 predicted 462
3 SASI_Rn01_00115205 predicted 333
4 SASI_Rn01_00115206 predicted 324
5 SASI_Rn01_00115207 predicted 461
6 SASI_Rn01_00115208 predicted 375
7 SASI_Rn02_00263158 predicted 282
8 SASI_Rn01_00115210 predicted 544
9 SASI_Rn01_00115211 predicted 705
10 SASI_Rn01_00115212 predicted 285
11 SASI_Rn01_00115209 predicted 340
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001131054 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311440 predicted 471
2 SASI_Mm02_00311441 predicted 300
3 SASI_Mm02_00311442 predicted 483
4 SASI_Mm02_00311443 predicted 399
5 SASI_Mm02_00311444 predicted 397
6 SASI_Mm02_00311445 predicted 413
7 SASI_Mm02_00311446 predicted 326
8 SASI_Mm02_00311447 predicted 328
9 SASI_Mm02_00311448 predicted 478
10 SASI_Mm02_00311449 predicted 243
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013917 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00020456 predicted 824
2 SASI_Mm01_00020457 predicted 390
3 SASI_Mm01_00020458 predicted 351
4 SASI_Mm01_00020459 predicted 727
5 SASI_Mm01_00020460 predicted 375
6 SASI_Mm01_00020461 predicted 649
7 SASI_Mm01_00020462 predicted 663
8 SASI_Mm01_00020463 predicted 461
9 SASI_Mm01_00020464 predicted 401
10 SASI_Mm01_00020465 predicted 403
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013917
VALIDATED
PTTG1 MISSION shRNA Bacterial Glycerol Stock
pituitary tumor-transforming 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000325155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013917.2-856s21c1
Sequence:CCGGGCTGTAAGCAACTTGTCACATCTCGAGATGTGACAAGTTGCTTACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013917.2-438s21c1
Sequence:CCGGCGAGTCGGCAAAGTGTTCAATCTCGAGATTGAACACTTTGCCGACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013917.1-856s1c1
Sequence:CCGGGCTGTAAGCAACTTGTCACATCTCGAGATGTGACAAGTTGCTTACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013917.1-438s1c1
Sequence:CCGGCGAGTCGGCAAAGTGTTCAATCTCGAGATTGAACACTTTGCCGACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013917.1-656s1c1
Sequence:CCGGCCCTTTCAATCCTCTAGACTTCTCGAGAAGTCTAGAGGATTGAAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013917.1-808s1c1
Sequence:CCGGCACCCTTTCTATCATGGGAATCTCGAGATTCCCATGATAGAAAGGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013917.1-467s1c1
Sequence:CCGGCGTGCCTAAAGCCAGCAGAAACTCGAGTTTCTGCTGGCTTTAGGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013917.2-467s21c1
Sequence:CCGGCGTGCCTAAAGCCAGCAGAAACTCGAGTTTCTGCTGGCTTTAGGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013917.2-808s21c1
Sequence:CCGGCACCCTTTCTATCATGGGAATCTCGAGATTCCCATGATAGAAAGGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013917.2-656s21c1
Sequence:CCGGCCCTTTCAATCCTCTAGACTTCTCGAGAAGTCTAGAGGATTGAAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013917
VALIDATED
PTTG1 MISSION shRNA shRNA Plasmid DNA
pituitary tumor-transforming 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000325155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013917.2-856s21c1
Sequence:CCGGGCTGTAAGCAACTTGTCACATCTCGAGATGTGACAAGTTGCTTACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013917.2-438s21c1
Sequence:CCGGCGAGTCGGCAAAGTGTTCAATCTCGAGATTGAACACTTTGCCGACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013917.1-856s1c1
Sequence:CCGGGCTGTAAGCAACTTGTCACATCTCGAGATGTGACAAGTTGCTTACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013917.1-438s1c1
Sequence:CCGGCGAGTCGGCAAAGTGTTCAATCTCGAGATTGAACACTTTGCCGACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013917.1-656s1c1
Sequence:CCGGCCCTTTCAATCCTCTAGACTTCTCGAGAAGTCTAGAGGATTGAAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013917.1-808s1c1
Sequence:CCGGCACCCTTTCTATCATGGGAATCTCGAGATTCCCATGATAGAAAGGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013917.1-467s1c1
Sequence:CCGGCGTGCCTAAAGCCAGCAGAAACTCGAGTTTCTGCTGGCTTTAGGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013917.2-467s21c1
Sequence:CCGGCGTGCCTAAAGCCAGCAGAAACTCGAGTTTCTGCTGGCTTTAGGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013917.2-808s21c1
Sequence:CCGGCACCCTTTCTATCATGGGAATCTCGAGATTCCCATGATAGAAAGGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013917.2-656s21c1
Sequence:CCGGCCCTTTCAATCCTCTAGACTTCTCGAGAAGTCTAGAGGATTGAAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013917
VALIDATED
PTTG1 MISSION shRNA Lentiviral Transduction Particles
pituitary tumor-transforming 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000325155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013917.2-856s21c1
Sequence:CCGGGCTGTAAGCAACTTGTCACATCTCGAGATGTGACAAGTTGCTTACAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013917.2-438s21c1
Sequence:CCGGCGAGTCGGCAAAGTGTTCAATCTCGAGATTGAACACTTTGCCGACTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013917.1-856s1c1
Sequence:CCGGGCTGTAAGCAACTTGTCACATCTCGAGATGTGACAAGTTGCTTACAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013917.1-438s1c1
Sequence:CCGGCGAGTCGGCAAAGTGTTCAATCTCGAGATTGAACACTTTGCCGACTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013917.1-656s1c1
Sequence:CCGGCCCTTTCAATCCTCTAGACTTCTCGAGAAGTCTAGAGGATTGAAAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013917.1-808s1c1
Sequence:CCGGCACCCTTTCTATCATGGGAATCTCGAGATTCCCATGATAGAAAGGGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013917.1-467s1c1
Sequence:CCGGCGTGCCTAAAGCCAGCAGAAACTCGAGTTTCTGCTGGCTTTAGGCACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013917.2-467s21c1
Sequence:CCGGCGTGCCTAAAGCCAGCAGAAACTCGAGTTTCTGCTGGCTTTAGGCACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013917.2-808s21c1
Sequence:CCGGCACCCTTTCTATCATGGGAATCTCGAGATTCCCATGATAGAAAGGGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013917.2-656s21c1
Sequence:CCGGCCCTTTCAATCCTCTAGACTTCTCGAGAAGTCTAGAGGATTGAAAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004219
VALIDATED
PTTG1 MISSION shRNA Bacterial Glycerol Stock
pituitary tumor-transforming 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000319034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004219.2-400s21c1
Sequence:CCGGCCCTTCAATCCTCTAGACTTTCTCGAGAAAGTCTAGAGGATTGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004219.2-133s1c1
Sequence:CCGGCCTTCAATCAAAGCCTTAGATCTCGAGATCTAAGGCTTTGATTGAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004219.2-572s1c1
Sequence:CCGGCCAATCTGTTGCAGTCTCCTTCTCGAGAAGGAGACTGCAACAGATTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004219.2-96s1c1
Sequence:CCGGTGTGGTTGCTAAGGATGGGCTCTCGAGAGCCCATCCTTAGCAACCACATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004219.2-400s1c1
Sequence:CCGGCCCTTCAATCCTCTAGACTTTCTCGAGAAAGTCTAGAGGATTGAAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004219.2-209s1c1
Sequence:CCGGCCTTACCTAAAGCTACTAGAACTCGAGTTCTAGTAGCTTTAGGTAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004219.2-209s21c1
Sequence:CCGGCCTTACCTAAAGCTACTAGAACTCGAGTTCTAGTAGCTTTAGGTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004219.2-572s21c1
Sequence:CCGGCCAATCTGTTGCAGTCTCCTTCTCGAGAAGGAGACTGCAACAGATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004219.2-133s21c1
Sequence:CCGGCCTTCAATCAAAGCCTTAGATCTCGAGATCTAAGGCTTTGATTGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004219
VALIDATED
PTTG1 MISSION shRNA shRNA Plasmid DNA
pituitary tumor-transforming 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000319034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004219.2-400s21c1
Sequence:CCGGCCCTTCAATCCTCTAGACTTTCTCGAGAAAGTCTAGAGGATTGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004219.2-133s1c1
Sequence:CCGGCCTTCAATCAAAGCCTTAGATCTCGAGATCTAAGGCTTTGATTGAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004219.2-572s1c1
Sequence:CCGGCCAATCTGTTGCAGTCTCCTTCTCGAGAAGGAGACTGCAACAGATTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004219.2-96s1c1
Sequence:CCGGTGTGGTTGCTAAGGATGGGCTCTCGAGAGCCCATCCTTAGCAACCACATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004219.2-400s1c1
Sequence:CCGGCCCTTCAATCCTCTAGACTTTCTCGAGAAAGTCTAGAGGATTGAAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004219.2-209s1c1
Sequence:CCGGCCTTACCTAAAGCTACTAGAACTCGAGTTCTAGTAGCTTTAGGTAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004219.2-209s21c1
Sequence:CCGGCCTTACCTAAAGCTACTAGAACTCGAGTTCTAGTAGCTTTAGGTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004219.2-572s21c1
Sequence:CCGGCCAATCTGTTGCAGTCTCCTTCTCGAGAAGGAGACTGCAACAGATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004219.2-133s21c1
Sequence:CCGGCCTTCAATCAAAGCCTTAGATCTCGAGATCTAAGGCTTTGATTGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004219
VALIDATED
PTTG1 MISSION shRNA Lentiviral Transduction Particles
pituitary tumor-transforming 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000319034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004219.2-400s21c1
Sequence:CCGGCCCTTCAATCCTCTAGACTTTCTCGAGAAAGTCTAGAGGATTGAAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004219.2-133s1c1
Sequence:CCGGCCTTCAATCAAAGCCTTAGATCTCGAGATCTAAGGCTTTGATTGAAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004219.2-572s1c1
Sequence:CCGGCCAATCTGTTGCAGTCTCCTTCTCGAGAAGGAGACTGCAACAGATTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004219.2-96s1c1
Sequence:CCGGTGTGGTTGCTAAGGATGGGCTCTCGAGAGCCCATCCTTAGCAACCACATTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004219.2-400s1c1
Sequence:CCGGCCCTTCAATCCTCTAGACTTTCTCGAGAAAGTCTAGAGGATTGAAGGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004219.2-209s1c1
Sequence:CCGGCCTTACCTAAAGCTACTAGAACTCGAGTTCTAGTAGCTTTAGGTAAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004219.2-209s21c1
Sequence:CCGGCCTTACCTAAAGCTACTAGAACTCGAGTTCTAGTAGCTTTAGGTAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004219.2-572s21c1
Sequence:CCGGCCAATCTGTTGCAGTCTCCTTCTCGAGAAGGAGACTGCAACAGATTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004219.2-133s21c1
Sequence:CCGGCCTTCAATCAAAGCCTTAGATCTCGAGATCTAAGGCTTTGATTGAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)