EMAIL THIS PAGE TO A FRIEND

PTX3

pentraxin 3, long

96 Gene Product Result for
Synonyms: TNFAIP5 TSG-14
UniProtKB ID: P26022, B2R6T6, Q38M82
Gene ID:
Mouse(19288) pentraxin related gene
Rat(689388) pentraxin 3, long
chicken(548626) pentraxin 3, long
dog(100685178) pentraxin 3, long
Horse(100500714) pentraxin 3, long
cow(541148) pentraxin 3, long
sheep(100034672) pentraxin 3, long
domestic guinea pig(100726587) pentraxin 3, long
naked mole-rat(101723987) pentraxin 3, long
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002852 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002852 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002852 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008987 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008987 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008987 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU153671 MISSION® esiRNA esiRNA human PTX3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002852 Rosetta Predictions human pricing
NM_001109536 Rosetta Predictions rat pricing
NM_008987 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002852 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211628 predicted 1442
2 SASI_Hs01_00211629 predicted 1157
3 SASI_Hs01_00211631 predicted 1482
4 SASI_Hs01_00211632 predicted 1164
5 SASI_Hs01_00211633 predicted 1369
6 SASI_Hs01_00211634 predicted 1484
7 SASI_Hs01_00211635 predicted 1159
8 SASI_Hs01_00211636 predicted 826
9 SASI_Hs01_00211637 predicted 819
10 SASI_Hs02_00334595 predicted 864
11 SASI_Hs01_00211630 predicted 1434
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109536 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249369 predicted 1358
2 SASI_Rn02_00249370 predicted 777
3 SASI_Rn02_00249371 predicted 1164
4 SASI_Rn02_00249372 predicted 792
5 SASI_Rn02_00249373 predicted 1329
6 SASI_Rn02_00249374 predicted 758
7 SASI_Rn02_00249375 predicted 919
8 SASI_Rn02_00249376 predicted 1283
9 SASI_Rn02_00249377 predicted 1146
10 SASI_Rn02_00249378 predicted 1308
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008987 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00148467 predicted 813
2 SASI_Mm02_00315081 predicted 1304
3 SASI_Mm01_00148469 predicted 215
4 SASI_Mm01_00148470 predicted 244
5 SASI_Mm01_00148471 predicted 1168
6 SASI_Mm01_00148472 predicted 931
7 SASI_Mm01_00148473 predicted 773
8 SASI_Mm01_00148474 predicted 1162
9 SASI_Mm02_00315082 predicted 1041
10 SASI_Mm01_00148475 predicted 1174
11 SASI_Mm01_00148468 predicted 1345
12 SASI_Mm01_00148476 predicted 1009
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002852
PTX3 MISSION shRNA Bacterial Glycerol Stock
pentraxin 3, long
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002852.3-191s21c1
Sequence:CCGGGGCCGAGAACTCGGATGATTACTCGAGTAATCATCCGAGTTCTCGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430959    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002852.3-1404s21c1
Sequence:CCGGGAGAGTTGAGACCAATCTTTACTCGAGTAAAGATTGGTCTCAACTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002852.2-1240s1c1
Sequence:CCGGGAGGAGCTCAGTATGTTTCATCTCGAGATGAAACATACTGAGCTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002852.2-672s1c1
Sequence:CCGGCCAATGCGTTCCAAGAAGATTCTCGAGAATCTTCTTGGAACGCATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149220    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002852.2-1480s1c1
Sequence:CCGGGCCATGGTGCTTTCAGTTTAACTCGAGTTAAACTGAAAGCACCATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002852.2-212s1c1
Sequence:CCGGCGAAATAGACAATGGACTCCACTCGAGTGGAGTCCATTGTCTATTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146265    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002852.2-1341s1c1
Sequence:CCGGCAGTGCATAATAGGAACACTTCTCGAGAAGTGTTCCTATTATGCACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002852
PTX3 MISSION shRNA shRNA Plasmid DNA
pentraxin 3, long
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002852.3-191s21c1
Sequence:CCGGGGCCGAGAACTCGGATGATTACTCGAGTAATCATCCGAGTTCTCGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430959    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002852.3-1404s21c1
Sequence:CCGGGAGAGTTGAGACCAATCTTTACTCGAGTAAAGATTGGTCTCAACTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002852.2-1240s1c1
Sequence:CCGGGAGGAGCTCAGTATGTTTCATCTCGAGATGAAACATACTGAGCTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002852.2-672s1c1
Sequence:CCGGCCAATGCGTTCCAAGAAGATTCTCGAGAATCTTCTTGGAACGCATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149220    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002852.2-1480s1c1
Sequence:CCGGGCCATGGTGCTTTCAGTTTAACTCGAGTTAAACTGAAAGCACCATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002852.2-212s1c1
Sequence:CCGGCGAAATAGACAATGGACTCCACTCGAGTGGAGTCCATTGTCTATTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146265    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002852.2-1341s1c1
Sequence:CCGGCAGTGCATAATAGGAACACTTCTCGAGAAGTGTTCCTATTATGCACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002852
PTX3 MISSION shRNA Lentiviral Transduction Particles
pentraxin 3, long
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002852.3-191s21c1
Sequence:CCGGGGCCGAGAACTCGGATGATTACTCGAGTAATCATCCGAGTTCTCGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430959    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002852.3-1404s21c1
Sequence:CCGGGAGAGTTGAGACCAATCTTTACTCGAGTAAAGATTGGTCTCAACTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002852.2-1240s1c1
Sequence:CCGGGAGGAGCTCAGTATGTTTCATCTCGAGATGAAACATACTGAGCTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002852.2-672s1c1
Sequence:CCGGCCAATGCGTTCCAAGAAGATTCTCGAGAATCTTCTTGGAACGCATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149220    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002852.2-1480s1c1
Sequence:CCGGGCCATGGTGCTTTCAGTTTAACTCGAGTTAAACTGAAAGCACCATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002852.2-212s1c1
Sequence:CCGGCGAAATAGACAATGGACTCCACTCGAGTGGAGTCCATTGTCTATTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146265    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002852.2-1341s1c1
Sequence:CCGGCAGTGCATAATAGGAACACTTCTCGAGAAGTGTTCCTATTATGCACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008987
PTX3 MISSION shRNA Bacterial Glycerol Stock
pentraxin 3, long
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008987.2-763s1c1
Sequence:CCGGGCATCCTGTGAGACCAATGAACTCGAGTTCATTGGTCTCACAGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008987.2-244s1c1
Sequence:CCGGCGAGCTCATGTATGTGAATTTCTCGAGAAATTCACATACATGAGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008987.2-720s1c1
Sequence:CCGGCAATTCTCTTCCCAATGCGTTCTCGAGAACGCATTGGGAAGAGAATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110915    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008987.2-1813s1c1
Sequence:CCGGCCAATGTTCCATTTGGGAGAACTCGAGTTCTCCCAAATGGAACATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008987.2-1141s1c1
Sequence:CCGGCTTTGACGAATCATTAGCATTCTCGAGAATGCTAATGATTCGTCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008987
PTX3 MISSION shRNA shRNA Plasmid DNA
pentraxin 3, long
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008987.2-763s1c1
Sequence:CCGGGCATCCTGTGAGACCAATGAACTCGAGTTCATTGGTCTCACAGGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008987.2-244s1c1
Sequence:CCGGCGAGCTCATGTATGTGAATTTCTCGAGAAATTCACATACATGAGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008987.2-720s1c1
Sequence:CCGGCAATTCTCTTCCCAATGCGTTCTCGAGAACGCATTGGGAAGAGAATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110915    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008987.2-1813s1c1
Sequence:CCGGCCAATGTTCCATTTGGGAGAACTCGAGTTCTCCCAAATGGAACATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008987.2-1141s1c1
Sequence:CCGGCTTTGACGAATCATTAGCATTCTCGAGAATGCTAATGATTCGTCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008987
PTX3 MISSION shRNA Lentiviral Transduction Particles
pentraxin 3, long
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008987.2-763s1c1
Sequence:CCGGGCATCCTGTGAGACCAATGAACTCGAGTTCATTGGTCTCACAGGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008987.2-244s1c1
Sequence:CCGGCGAGCTCATGTATGTGAATTTCTCGAGAAATTCACATACATGAGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008987.2-720s1c1
Sequence:CCGGCAATTCTCTTCCCAATGCGTTCTCGAGAACGCATTGGGAAGAGAATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110915    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008987.2-1813s1c1
Sequence:CCGGCCAATGTTCCATTTGGGAGAACTCGAGTTCTCCCAAATGGAACATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008987.2-1141s1c1
Sequence:CCGGCTTTGACGAATCATTAGCATTCTCGAGAATGCTAATGATTCGTCAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)