EMAIL THIS PAGE TO A FRIEND

PTX4

pentraxin 4, long

62 Gene Product Result for
Synonyms: C16orf38
UniProtKB ID: Q96A99
Gene ID:
Human(390667) Summary: PTX4 belongs to the pentraxin (PTX) superfamily of multifunctional conserved proteins. Pentraxins are characterized by a cyclic multimeric structure and a conserved C-terminal pentraxin domain of approximately 200 amino acids. All pentraxins have a conserved 8-amino acid sequence, HxCxS/TWxS, in which x is any amino acid, within their pentraxin domain. Pentraxins are divided into short proteins, such as C-reactive protein (CRP; MIM 123260) and serum amyloid P protein (APCS; MIM 104770), and long proteins, such as PTX3 (MIM 602492) and PTX4. Some PTXs are part of the humoral arm of innate immunity and behave as functional ancestors of antibodies by mediating agglutination, complement activation, and opsonization (summary by Martinez de la Torre et al., 2010 [PubMed 20357257]
Mouse(68509) pentraxin 4
Rat(287130) pentraxin 4, long
Zebrafish(100004372) pentraxin 4, long
dog(611160) pentraxin 4, long
Horse(100067728) pentraxin 4, long
domestic cat(101087291) pentraxin 4, long
naked mole-rat(101711692) pentraxin 4, long
domestic guinea pig(100728185) pentraxin 4, long
cow(524063) pentraxin 4, long
sheep(101108979) pentraxin 4, long
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA073694 Anti-PTX4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026747 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026747 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026747 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001013658 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013658 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013658 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013658 Rosetta Predictions human pricing
XM_001059245 Rosetta Predictions rat pricing
XM_220237 Rosetta Predictions rat pricing
XM_128459 Rosetta Predictions mouse pricing
XM_914629 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013658 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088764 predicted 1098
2 SASI_Hs01_00088766 predicted 835
3 SASI_Hs01_00088768 predicted 404
4 SASI_Hs01_00088769 predicted 987
5 SASI_Hs01_00088770 predicted 1100
6 SASI_Hs01_00088771 predicted 1020
7 SASI_Hs02_00306428 predicted 290
8 SASI_Hs01_00088773 predicted 827
9 SASI_Hs02_00306429 predicted 918
10 SASI_Hs01_00088765 predicted 583
11 SASI_Hs01_00088767 predicted 1149
12 SASI_Hs01_00088772 predicted 1143
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059245 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00292588 predicted 767
2 SASI_Rn02_00292589 predicted 248
3 SASI_Rn02_00292590 predicted 308
4 SASI_Rn02_00292591 predicted 685
5 SASI_Rn02_00292592 predicted 460
6 SASI_Rn02_00292593 predicted 306
7 SASI_Rn02_00292594 predicted 1154
8 SASI_Rn02_00292595 predicted 1002
9 SASI_Rn02_00292596 predicted 348
10 SASI_Rn02_00292597 predicted 244
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220237 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379155 predicted 772
2 SASI_Rn02_00379156 predicted 247
3 SASI_Rn02_00379157 predicted 301
4 SASI_Rn02_00379158 predicted 687
5 SASI_Rn02_00379159 predicted 458
6 SASI_Rn02_00379160 predicted 305
7 SASI_Rn02_00379161 predicted 1160
8 SASI_Rn02_00379162 predicted 1009
9 SASI_Rn02_00379163 predicted 343
10 SASI_Rn02_00379164 predicted 246
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_128459 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00280285 predicted 436
2 SASI_Mm01_00280286 predicted 1021
3 SASI_Mm01_00280287 predicted 609
4 SASI_Mm01_00280288 predicted 948
5 SASI_Mm01_00280289 predicted 678
6 SASI_Mm01_00280290 predicted 935
7 SASI_Mm01_00280291 predicted 437
8 SASI_Mm01_00280292 predicted 1060
9 SASI_Mm02_00424256 predicted 764
10 SASI_Mm02_00424257 predicted 1093
11 SASI_Mm01_00280283 predicted 1217
12 SASI_Mm01_00280284 predicted 862
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_914629 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00438740 predicted 438
2 SASI_Mm02_00438741 predicted 1022
3 SASI_Mm02_00438742 predicted 680
4 SASI_Mm02_00438743 predicted 613
5 SASI_Mm02_00438744 predicted 947
6 SASI_Mm02_00438745 predicted 937
7 SASI_Mm02_00438746 predicted 437
8 SASI_Mm02_00438747 predicted 1057
9 SASI_Mm02_00438748 predicted 767
10 SASI_Mm02_00438749 predicted 1096
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026747
PTX4 MISSION shRNA Bacterial Glycerol Stock
pentraxin 4, long
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026747.1-397s21c1
Sequence:CCGGCCATTTAAAGACCTGGTATAGCTCGAGCTATACCAGGTCTTTAAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026747.1-894s21c1
Sequence:CCGGACACGGACCCAGTGCTGATTTCTCGAGAAATCAGCACTGGGTCCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026747.1-345s21c1
Sequence:CCGGCCGTAGCTCTAGCGATGAATCCTCGAGGATTCATCGCTAGAGCTACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026747.1-1161s21c1
Sequence:CCGGATGGCCAGTGGCACCACATTTCTCGAGAAATGTGGTGCCACTGGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026747.1-285s21c1
Sequence:CCGGACTACAATGTTTACCACAATACTCGAGTATTGTGGTAAACATTGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026747
PTX4 MISSION shRNA shRNA Plasmid DNA
pentraxin 4, long
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026747.1-397s21c1
Sequence:CCGGCCATTTAAAGACCTGGTATAGCTCGAGCTATACCAGGTCTTTAAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026747.1-894s21c1
Sequence:CCGGACACGGACCCAGTGCTGATTTCTCGAGAAATCAGCACTGGGTCCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026747.1-345s21c1
Sequence:CCGGCCGTAGCTCTAGCGATGAATCCTCGAGGATTCATCGCTAGAGCTACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026747.1-1161s21c1
Sequence:CCGGATGGCCAGTGGCACCACATTTCTCGAGAAATGTGGTGCCACTGGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026747.1-285s21c1
Sequence:CCGGACTACAATGTTTACCACAATACTCGAGTATTGTGGTAAACATTGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026747
PTX4 MISSION shRNA Lentiviral Transduction Particles
pentraxin 4, long
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026747.1-397s21c1
Sequence:CCGGCCATTTAAAGACCTGGTATAGCTCGAGCTATACCAGGTCTTTAAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026747.1-894s21c1
Sequence:CCGGACACGGACCCAGTGCTGATTTCTCGAGAAATCAGCACTGGGTCCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026747.1-345s21c1
Sequence:CCGGCCGTAGCTCTAGCGATGAATCCTCGAGGATTCATCGCTAGAGCTACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026747.1-1161s21c1
Sequence:CCGGATGGCCAGTGGCACCACATTTCTCGAGAAATGTGGTGCCACTGGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026747.1-285s21c1
Sequence:CCGGACTACAATGTTTACCACAATACTCGAGTATTGTGGTAAACATTGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013658
PTX4 MISSION shRNA Bacterial Glycerol Stock
pentraxin 4, long
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013658.1-1149s21c1
Sequence:CCGGCTTCAGGGAGGGCTATGAGATCTCGAGATCTCATAGCCCTCCCTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013658.1-165s1c1
Sequence:CCGGGAACATCGCCAGCAACTACAACTCGAGTTGTAGTTGCTGGCGATGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013658.1-193s21c1
Sequence:CCGGTACAACGTTGACGTCCGGTTCCTCGAGGAACCGGACGTCAACGTTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013658.1-991s21c1
Sequence:CCGGGGATCCATCCACTTCGTGATCCTCGAGGATCACGAAGTGGATGGATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013658.1-1252s21c1
Sequence:CCGGAGCATGTCTGGCTTGGCTATCCTCGAGGATAGCCAAGCCAGACATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013658.1-177s1c1
Sequence:CCGGCAACTACAACGTGTCCTACAACTCGAGTTGTAGGACACGTTGTAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013658.1-176s1c1
Sequence:CCGGGCAACTACAACGTGTCCTACACTCGAGTGTAGGACACGTTGTAGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013658.1-165s21c1
Sequence:CCGGGAACATCGCCAGCAACTACAACTCGAGTTGTAGTTGCTGGCGATGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013658
PTX4 MISSION shRNA shRNA Plasmid DNA
pentraxin 4, long
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013658.1-1149s21c1
Sequence:CCGGCTTCAGGGAGGGCTATGAGATCTCGAGATCTCATAGCCCTCCCTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013658.1-165s1c1
Sequence:CCGGGAACATCGCCAGCAACTACAACTCGAGTTGTAGTTGCTGGCGATGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013658.1-193s21c1
Sequence:CCGGTACAACGTTGACGTCCGGTTCCTCGAGGAACCGGACGTCAACGTTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013658.1-991s21c1
Sequence:CCGGGGATCCATCCACTTCGTGATCCTCGAGGATCACGAAGTGGATGGATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013658.1-1252s21c1
Sequence:CCGGAGCATGTCTGGCTTGGCTATCCTCGAGGATAGCCAAGCCAGACATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013658.1-177s1c1
Sequence:CCGGCAACTACAACGTGTCCTACAACTCGAGTTGTAGGACACGTTGTAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013658.1-176s1c1
Sequence:CCGGGCAACTACAACGTGTCCTACACTCGAGTGTAGGACACGTTGTAGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013658.1-165s21c1
Sequence:CCGGGAACATCGCCAGCAACTACAACTCGAGTTGTAGTTGCTGGCGATGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013658
PTX4 MISSION shRNA Lentiviral Transduction Particles
pentraxin 4, long
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013658.1-1149s21c1
Sequence:CCGGCTTCAGGGAGGGCTATGAGATCTCGAGATCTCATAGCCCTCCCTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013658.1-165s1c1
Sequence:CCGGGAACATCGCCAGCAACTACAACTCGAGTTGTAGTTGCTGGCGATGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013658.1-193s21c1
Sequence:CCGGTACAACGTTGACGTCCGGTTCCTCGAGGAACCGGACGTCAACGTTGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013658.1-991s21c1
Sequence:CCGGGGATCCATCCACTTCGTGATCCTCGAGGATCACGAAGTGGATGGATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013658.1-1252s21c1
Sequence:CCGGAGCATGTCTGGCTTGGCTATCCTCGAGGATAGCCAAGCCAGACATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013658.1-177s1c1
Sequence:CCGGCAACTACAACGTGTCCTACAACTCGAGTTGTAGGACACGTTGTAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013658.1-176s1c1
Sequence:CCGGGCAACTACAACGTGTCCTACACTCGAGTGTAGGACACGTTGTAGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013658.1-165s21c1
Sequence:CCGGGAACATCGCCAGCAACTACAACTCGAGTTGTAGTTGCTGGCGATGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)