EMAIL THIS PAGE TO A FRIEND

PUF60

poly-U binding splicing factor 60KDa

103 Gene Product Result for
Synonyms: FIR RoBPI SIAHBP1
Gene ID:
Human(22827) Summary: This gene encodes a nucleic acid-binding protein that plays a role in a variety of nuclear processes, including pre-mRNA splicing and transcriptional regulation. The encoded protein forms a complex with the far upstream DNA element (FUSE) and FUSE-binding protein at the myelocytomatosis oncogene (MYC) promoter. This complex represses MYC transcription through the core-TFIIH basal transcription factor. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2012]
Mouse(67959) poly-U binding splicing factor 60
Rat(84401) poly-U binding splicing factor 60
chicken(426402) poly-U binding splicing factor 60KDa
dog(607245) poly-U binding splicing factor 60KDa
domestic cat(101092241) poly-U binding splicing factor 60KDa
cow(512824) poly-U binding splicing factor 60KDa
sheep(101112401) poly-U binding splicing factor 60KDa
domestic guinea pig(100734967) poly-U binding splicing factor 60KDa
naked mole-rat(101711469) poly-U binding splicing factor 60KDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014281 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014281 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014281 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133691 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133691 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133691 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014281 Rosetta Predictions human pricing
NM_078480 Rosetta Predictions human pricing
XM_001057313 Rosetta Predictions rat pricing
XM_001070780 Rosetta Predictions rat pricing
XM_001071005 Rosetta Predictions rat pricing
XM_343268 Rosetta Predictions rat pricing
NM_028364 Rosetta Predictions mouse pricing
NM_133691 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014281 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104467 predicted 1397
2 SASI_Hs01_00104469 predicted 719
3 SASI_Hs01_00104470 predicted 1303
4 SASI_Hs01_00104471 predicted 1393
5 SASI_Hs01_00104472 predicted 862
6 SASI_Hs01_00104475 predicted 843
7 SASI_Hs01_00104476 predicted 1337
8 SASI_Hs02_00345356 predicted 815
9 SASI_Hs02_00345357 predicted 1167
10 SASI_Hs02_00345358 predicted 654
11 SASI_Hs01_00104468 predicted 1607
12 SASI_Hs01_00104473 predicted 1461
13 SASI_Hs01_00104474 predicted 1535
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_078480 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170065 predicted 1444
2 SASI_Hs01_00170067 predicted 763
3 SASI_Hs01_00170068 predicted 1347
4 SASI_Hs01_00170069 predicted 1448
5 SASI_Hs01_00170070 predicted 911
6 SASI_Hs01_00170073 predicted 894
7 SASI_Hs01_00170074 predicted 1388
8 SASI_Hs02_00362165 predicted 864
9 SASI_Hs02_00362166 predicted 1219
10 SASI_Hs02_00362167 predicted 702
11 SASI_Hs01_00170066 predicted 1653
12 SASI_Hs01_00170071 predicted 1516
13 SASI_Hs01_00170072 predicted 1594
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057313 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00285983 predicted 1217
2 SASI_Rn02_00285984 predicted 417
3 SASI_Rn02_00285985 predicted 1583
4 SASI_Rn02_00285986 predicted 1532
5 SASI_Rn02_00285987 predicted 1350
6 SASI_Rn02_00285988 predicted 397
7 SASI_Rn02_00285989 predicted 1053
8 SASI_Rn02_00285990 predicted 1372
9 SASI_Rn02_00285991 predicted 911
10 SASI_Rn02_00285992 predicted 1585
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070780 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00332765 predicted 1216
2 SASI_Rn02_00332766 predicted 416
3 SASI_Rn02_00332767 predicted 1579
4 SASI_Rn02_00332768 predicted 1531
5 SASI_Rn02_00332769 predicted 1351
6 SASI_Rn02_00332770 predicted 399
7 SASI_Rn02_00332771 predicted 1049
8 SASI_Rn02_00332772 predicted 1369
9 SASI_Rn02_00332773 predicted 917
10 SASI_Rn02_00332774 predicted 1581
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071005 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00333567 predicted 1236
2 SASI_Rn02_00333568 predicted 467
3 SASI_Rn02_00333569 predicted 1599
4 SASI_Rn02_00333570 predicted 1546
5 SASI_Rn02_00333571 predicted 1366
6 SASI_Rn02_00333572 predicted 448
7 SASI_Rn02_00333573 predicted 1067
8 SASI_Rn02_00333574 predicted 1395
9 SASI_Rn02_00333575 predicted 933
10 SASI_Rn02_00333576 predicted 1602
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343268 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395563 predicted 1243
2 SASI_Rn02_00395564 predicted 467
3 SASI_Rn02_00395565 predicted 1601
4 SASI_Rn02_00395566 predicted 1548
5 SASI_Rn02_00395567 predicted 1370
6 SASI_Rn02_00395568 predicted 454
7 SASI_Rn02_00395569 predicted 1070
8 SASI_Rn02_00395570 predicted 1392
9 SASI_Rn02_00395571 predicted 928
10 SASI_Rn02_00395572 predicted 1599
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028364 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00040182 predicted 1212
2 SASI_Mm01_00040183 predicted 719
3 SASI_Mm01_00040184 predicted 725
4 SASI_Mm01_00040185 predicted 1431
5 SASI_Mm01_00040187 predicted 1341
6 SASI_Mm01_00040188 predicted 892
7 SASI_Mm01_00040190 predicted 1422
8 SASI_Mm02_00333738 predicted 897
9 SASI_Mm02_00333739 predicted 782
10 SASI_Mm02_00333740 predicted 1041
11 SASI_Mm01_00040181 predicted 1523
12 SASI_Mm01_00040186 predicted 1497
13 SASI_Mm01_00040189 predicted 1181
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133691 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046754 predicted 1153
2 SASI_Mm01_00046755 predicted 660
3 SASI_Mm01_00046756 predicted 668
4 SASI_Mm01_00046757 predicted 1385
5 SASI_Mm01_00046759 predicted 1289
6 SASI_Mm01_00046760 predicted 840
7 SASI_Mm01_00046762 predicted 1372
8 SASI_Mm02_00338651 predicted 843
9 SASI_Mm02_00338652 predicted 726
10 SASI_Mm02_00338653 predicted 989
11 SASI_Mm01_00046753 predicted 1479
12 SASI_Mm01_00046758 predicted 1443
13 SASI_Mm01_00046761 predicted 1136
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014281
VALIDATED
PUF60 MISSION shRNA Bacterial Glycerol Stock
poly-U binding splicing factor 60KDa
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000322893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_014281.3-730s21c1
Sequence:CCGGCGATGACATCAAGAGCGTGTTCTCGAGAACACGCTCTTGATGTCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014281.3-1499s21c1
Sequence:CCGGGTCATCATCTACCAAGAGAAACTCGAGTTTCTCTTGGTAGATGATGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014281.3-849s1c1
Sequence:CCGGCGTCCCAAGATGCTGTGTCTTCTCGAGAAGACACAGCATCTTGGGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_014281.3-408s21c1
Sequence:CCGGACGTGGGCTCTATCTACTATGCTCGAGCATAGTAGATAGAGCCCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_014281.3-730s1c1
Sequence:CCGGCGATGACATCAAGAGCGTGTTCTCGAGAACACGCTCTTGATGTCATCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014281.3-1499s1c1
Sequence:CCGGGTCATCATCTACCAAGAGAAACTCGAGTTTCTCTTGGTAGATGATGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014281.3-1537s1c1
Sequence:CCGGTGCAGAAATCATTGTCAAGATCTCGAGATCTTGACAATGATTTCTGCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014281.3-181s1c1
Sequence:CCGGAGACTCCATCAAGATGGAGAACTCGAGTTCTCCATCTTGATGGAGTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_014281.3-1537s21c1
Sequence:CCGGTGCAGAAATCATTGTCAAGATCTCGAGATCTTGACAATGATTTCTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014281
VALIDATED
PUF60 MISSION shRNA shRNA Plasmid DNA
poly-U binding splicing factor 60KDa
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000322893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_014281.3-730s21c1
Sequence:CCGGCGATGACATCAAGAGCGTGTTCTCGAGAACACGCTCTTGATGTCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014281.3-1499s21c1
Sequence:CCGGGTCATCATCTACCAAGAGAAACTCGAGTTTCTCTTGGTAGATGATGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014281.3-849s1c1
Sequence:CCGGCGTCCCAAGATGCTGTGTCTTCTCGAGAAGACACAGCATCTTGGGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_014281.3-408s21c1
Sequence:CCGGACGTGGGCTCTATCTACTATGCTCGAGCATAGTAGATAGAGCCCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_014281.3-730s1c1
Sequence:CCGGCGATGACATCAAGAGCGTGTTCTCGAGAACACGCTCTTGATGTCATCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014281.3-1499s1c1
Sequence:CCGGGTCATCATCTACCAAGAGAAACTCGAGTTTCTCTTGGTAGATGATGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014281.3-1537s1c1
Sequence:CCGGTGCAGAAATCATTGTCAAGATCTCGAGATCTTGACAATGATTTCTGCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014281.3-181s1c1
Sequence:CCGGAGACTCCATCAAGATGGAGAACTCGAGTTCTCCATCTTGATGGAGTCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_014281.3-1537s21c1
Sequence:CCGGTGCAGAAATCATTGTCAAGATCTCGAGATCTTGACAATGATTTCTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014281
VALIDATED
PUF60 MISSION shRNA Lentiviral Transduction Particles
poly-U binding splicing factor 60KDa
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000322893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_014281.3-730s21c1
Sequence:CCGGCGATGACATCAAGAGCGTGTTCTCGAGAACACGCTCTTGATGTCATCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014281.3-1499s21c1
Sequence:CCGGGTCATCATCTACCAAGAGAAACTCGAGTTTCTCTTGGTAGATGATGACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014281.3-849s1c1
Sequence:CCGGCGTCCCAAGATGCTGTGTCTTCTCGAGAAGACACAGCATCTTGGGACGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_014281.3-408s21c1
Sequence:CCGGACGTGGGCTCTATCTACTATGCTCGAGCATAGTAGATAGAGCCCACGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_014281.3-730s1c1
Sequence:CCGGCGATGACATCAAGAGCGTGTTCTCGAGAACACGCTCTTGATGTCATCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014281.3-1499s1c1
Sequence:CCGGGTCATCATCTACCAAGAGAAACTCGAGTTTCTCTTGGTAGATGATGACTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014281.3-1537s1c1
Sequence:CCGGTGCAGAAATCATTGTCAAGATCTCGAGATCTTGACAATGATTTCTGCATTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014281.3-181s1c1
Sequence:CCGGAGACTCCATCAAGATGGAGAACTCGAGTTCTCCATCTTGATGGAGTCTTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_014281.3-1537s21c1
Sequence:CCGGTGCAGAAATCATTGTCAAGATCTCGAGATCTTGACAATGATTTCTGCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133691
VALIDATED
PUF60 MISSION shRNA Bacterial Glycerol Stock
poly-U binding splicing factor 60KDa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133691.1-1532s1c1
Sequence:CCGGGCAGAAATCATCGTCAAGATTCTCGAGAATCTTGACGATGATTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133691.1-671s1c1
Sequence:CCGGGCTAGGGCTTTCAACCGAATACTCGAGTATTCGGTTGAAAGCCCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133691.1-724s1c1
Sequence:CCGGTGATGACATCAAGAGTGTATTCTCGAGAATACACTCTTGATGTCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133691.1-733s1c1
Sequence:CCGGCAAGAGTGTATTTGAAGCCTTCTCGAGAAGGCTTCAAATACACTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133691.1-672s1c1
Sequence:CCGGCTAGGGCTTTCAACCGAATATCTCGAGATATTCGGTTGAAAGCCCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133691
VALIDATED
PUF60 MISSION shRNA shRNA Plasmid DNA
poly-U binding splicing factor 60KDa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133691.1-1532s1c1
Sequence:CCGGGCAGAAATCATCGTCAAGATTCTCGAGAATCTTGACGATGATTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133691.1-671s1c1
Sequence:CCGGGCTAGGGCTTTCAACCGAATACTCGAGTATTCGGTTGAAAGCCCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133691.1-724s1c1
Sequence:CCGGTGATGACATCAAGAGTGTATTCTCGAGAATACACTCTTGATGTCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133691.1-733s1c1
Sequence:CCGGCAAGAGTGTATTTGAAGCCTTCTCGAGAAGGCTTCAAATACACTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133691.1-672s1c1
Sequence:CCGGCTAGGGCTTTCAACCGAATATCTCGAGATATTCGGTTGAAAGCCCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133691
VALIDATED
PUF60 MISSION shRNA Lentiviral Transduction Particles
poly-U binding splicing factor 60KDa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133691.1-1532s1c1
Sequence:CCGGGCAGAAATCATCGTCAAGATTCTCGAGAATCTTGACGATGATTTCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133691.1-671s1c1
Sequence:CCGGGCTAGGGCTTTCAACCGAATACTCGAGTATTCGGTTGAAAGCCCTAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133691.1-724s1c1
Sequence:CCGGTGATGACATCAAGAGTGTATTCTCGAGAATACACTCTTGATGTCATCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133691.1-733s1c1
Sequence:CCGGCAAGAGTGTATTTGAAGCCTTCTCGAGAAGGCTTCAAATACACTCTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133691.1-672s1c1
Sequence:CCGGCTAGGGCTTTCAACCGAATATCTCGAGATATTCGGTTGAAAGCCCTAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)