EMAIL THIS PAGE TO A FRIEND

PUM1

pumilio RNA-binding family member 1

130 Gene Product Result for
Synonyms: HSPUM PUMH PUMH1 PUML1
Gene ID:
Human(9698) Summary: This gene encodes a member of the PUF family, evolutionarily conserved RNA-binding proteins related to the Pumilio proteins of Drosophila and the fem-3 mRNA binding factor proteins of C. elegans. The encoded protein contains a sequence-specific RNA binding domain comprised of eight repeats and N- and C-terminal flanking regions, and serves as a translational regulator of specific mRNAs by binding to their 3' untranslated regions. The evolutionarily conserved function of the encoded protein in invertebrates and lower vertebrates suggests that the human protein may be involved in translational regulation of embryogenesis, and cell development and differentiation. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Mouse(80912) pumilio 1 (Drosophila)
Rat(362609) pumilio homolog 1 (Drosophila)
chicken(419554) pumilio homolog 1 (Drosophila)
Zebrafish(394176) pumilio homolog 1 (Drosophila)
domestic cat(101093375) pumilio homolog 1 (Drosophila)
Horse(100070514) pumilio homolog 1 (Drosophila)
dog(478158) pumilio homolog 1 (Drosophila)
cow(535450) pumilio homolog 1 (Drosophila)
sheep(101120896) pumilio homolog 1 (Drosophila)
naked mole-rat(101698365) pumilio homolog 1 (Drosophila)
Domestic Rabbit(100348757) pumilio homolog 1 (Drosophila)
domestic guinea pig(100735839) pumilio homolog 1 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014676 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014676 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014676 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030722 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030722 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030722 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU001311 MISSION® esiRNA esiRNA targeting human PUM1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001020658 Rosetta Predictions human pricing
NM_014676 Rosetta Predictions human pricing
NM_001108684 Rosetta Predictions rat pricing
NM_030722 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001020658 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188988 predicted 970
2 SASI_Hs01_00188989 predicted 680
3 SASI_Hs01_00188991 predicted 892
4 SASI_Hs01_00188992 predicted 3317
5 SASI_Hs01_00188993 predicted 3366
6 SASI_Hs01_00188994 predicted 2400
7 SASI_Hs01_00188996 predicted 572
8 SASI_Hs01_00188997 predicted 1278
9 SASI_Hs02_00307057 predicted 1504
10 SASI_Hs02_00307058 predicted 2565
11 SASI_Hs01_00188990 predicted 3247
12 SASI_Hs01_00188995 predicted 3343
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014676 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113788 predicted 972
2 SASI_Hs01_00113789 predicted 682
3 SASI_Hs01_00113791 predicted 895
4 SASI_Hs01_00113792 predicted 3314
5 SASI_Hs01_00113793 predicted 3361
6 SASI_Hs01_00113794 predicted 2400
7 SASI_Hs01_00113796 predicted 569
8 SASI_Hs01_00113797 predicted 1277
9 SASI_Hs02_00346029 predicted 1510
10 SASI_Hs02_00346030 predicted 2559
11 SASI_Hs01_00113790 predicted 3239
12 SASI_Hs01_00113795 predicted 3335
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108684 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241055 predicted 949
2 SASI_Rn02_00241056 predicted 2630
3 SASI_Rn02_00241057 predicted 868
4 SASI_Rn02_00241058 predicted 3220
5 SASI_Rn02_00241059 predicted 1489
6 SASI_Rn02_00241060 predicted 455
7 SASI_Rn02_00241061 predicted 3314
8 SASI_Rn02_00241062 predicted 2385
9 SASI_Rn02_00241063 predicted 1689
10 SASI_Rn02_00241064 predicted 657
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030722 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00180718 predicted 3348
2 SASI_Mm01_00180719 predicted 948
3 SASI_Mm01_00180720 predicted 2631
4 SASI_Mm02_00336909 predicted 659
5 SASI_Mm01_00180721 predicted 869
6 SASI_Mm01_00180722 predicted 2844
7 SASI_Mm01_00180723 predicted 3219
8 SASI_Mm01_00180724 predicted 2383
9 SASI_Mm01_00180725 predicted 2538
10 SASI_Mm01_00180726 predicted 1484
11 SASI_Mm01_00180727 predicted 3326
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014676
VALIDATED
PUM1 MISSION shRNA Bacterial Glycerol Stock
pumilio RNA-binding family member 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000275487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014676.2-1560s21c1
Sequence:CCGGGCAGCAACTAATTCAGCTAATCTCGAGATTAGCTGAATTAGTTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014676.1-2021s1c1
Sequence:CCGGCAGTTCTTTCTACGGCAACAACTCGAGTTGTTGCCGTAGAAAGAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014676.1-2729s1c1
Sequence:CCGGCCAGCTTGTCTTCAATGAAATCTCGAGATTTCATTGAAGACAAGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014676.1-1542s1c1
Sequence:CCGGGCAGCAACTAATTCAGCTAATCTCGAGATTAGCTGAATTAGTTGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014676.1-2236s1c1
Sequence:CCGGGTGACCTTTATAAGAGGACATCTCGAGATGTCCTCTTATAAAGGTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014676.1-1464s1c1
Sequence:CCGGCCTCACCAGTATTATGGAGTTCTCGAGAACTCCATAATACTGGTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275486    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014676.2-3948s21c1
Sequence:CCGGTACATGGGAGGCCACATATTTCTCGAGAAATATGTGGCCTCCCATGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014676.2-3087s21c1
Sequence:CCGGGCGTTTAAGGGACAGGTATTTCTCGAGAAATACCTGTCCCTTAAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014676.2-3169s21c1
Sequence:CCGGCTGACCAGACACTCCCTATTTCTCGAGAAATAGGGAGTGTCTGGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014676.2-2747s21c1
Sequence:CCGGCCAGCTTGTCTTCAATGAAATCTCGAGATTTCATTGAAGACAAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014676
VALIDATED
PUM1 MISSION shRNA shRNA Plasmid DNA
pumilio RNA-binding family member 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000275487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014676.2-1560s21c1
Sequence:CCGGGCAGCAACTAATTCAGCTAATCTCGAGATTAGCTGAATTAGTTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014676.1-2021s1c1
Sequence:CCGGCAGTTCTTTCTACGGCAACAACTCGAGTTGTTGCCGTAGAAAGAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014676.1-2729s1c1
Sequence:CCGGCCAGCTTGTCTTCAATGAAATCTCGAGATTTCATTGAAGACAAGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014676.1-1542s1c1
Sequence:CCGGGCAGCAACTAATTCAGCTAATCTCGAGATTAGCTGAATTAGTTGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014676.1-2236s1c1
Sequence:CCGGGTGACCTTTATAAGAGGACATCTCGAGATGTCCTCTTATAAAGGTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014676.1-1464s1c1
Sequence:CCGGCCTCACCAGTATTATGGAGTTCTCGAGAACTCCATAATACTGGTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275486    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014676.2-3948s21c1
Sequence:CCGGTACATGGGAGGCCACATATTTCTCGAGAAATATGTGGCCTCCCATGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014676.2-3087s21c1
Sequence:CCGGGCGTTTAAGGGACAGGTATTTCTCGAGAAATACCTGTCCCTTAAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014676.2-3169s21c1
Sequence:CCGGCTGACCAGACACTCCCTATTTCTCGAGAAATAGGGAGTGTCTGGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014676.2-2747s21c1
Sequence:CCGGCCAGCTTGTCTTCAATGAAATCTCGAGATTTCATTGAAGACAAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014676
VALIDATED
PUM1 MISSION shRNA Lentiviral Transduction Particles
pumilio RNA-binding family member 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000275487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014676.2-1560s21c1
Sequence:CCGGGCAGCAACTAATTCAGCTAATCTCGAGATTAGCTGAATTAGTTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014676.1-2021s1c1
Sequence:CCGGCAGTTCTTTCTACGGCAACAACTCGAGTTGTTGCCGTAGAAAGAACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014676.1-2729s1c1
Sequence:CCGGCCAGCTTGTCTTCAATGAAATCTCGAGATTTCATTGAAGACAAGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014676.1-1542s1c1
Sequence:CCGGGCAGCAACTAATTCAGCTAATCTCGAGATTAGCTGAATTAGTTGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014676.1-2236s1c1
Sequence:CCGGGTGACCTTTATAAGAGGACATCTCGAGATGTCCTCTTATAAAGGTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014676.1-1464s1c1
Sequence:CCGGCCTCACCAGTATTATGGAGTTCTCGAGAACTCCATAATACTGGTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275486    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014676.2-3948s21c1
Sequence:CCGGTACATGGGAGGCCACATATTTCTCGAGAAATATGTGGCCTCCCATGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014676.2-3087s21c1
Sequence:CCGGGCGTTTAAGGGACAGGTATTTCTCGAGAAATACCTGTCCCTTAAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014676.2-3169s21c1
Sequence:CCGGCTGACCAGACACTCCCTATTTCTCGAGAAATAGGGAGTGTCTGGTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014676.2-2747s21c1
Sequence:CCGGCCAGCTTGTCTTCAATGAAATCTCGAGATTTCATTGAAGACAAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030722
VALIDATED
PUM1 MISSION shRNA Bacterial Glycerol Stock
pumilio RNA-binding family member 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030722.1-2641s1c1
Sequence:CCGGGCTGGGCATATAATGGAATTTCTCGAGAAATTCCATTATATGCCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030722.1-457s1c1
Sequence:CCGGCGCTCTATGGATGAATTGAATCTCGAGATTCAATTCATCCATAGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030722.1-1756s1c1
Sequence:CCGGCCTGCTGCTTACTATGACCAACTCGAGTTGGTCATAGTAAGCAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030722.1-2763s1c1
Sequence:CCGGCCAACTTATGGTGGATGTGTTCTCGAGAACACATCCACCATAAGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102250    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030722.1-3880s1c1
Sequence:CCGGCCCTGCTGTTTACTGGTGTATCTCGAGATACACCAGTAAACAGCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030722.2-2793s21c1
Sequence:CCGGCCAACTTATGGTGGATGTGTTCTCGAGAACACATCCACCATAAGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294814    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030722.2-4171s21c1
Sequence:CCGGTGATCTCAAACTGGCATTTAACTCGAGTTAAATGCCAGTTTGAGATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030722.2-2671s21c1
Sequence:CCGGGCTGGGCATATAATGGAATTTCTCGAGAAATTCCATTATATGCCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030722.2-1786s21c1
Sequence:CCGGCCTGCTGCTTACTATGACCAACTCGAGTTGGTCATAGTAAGCAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030722.2-487s21c1
Sequence:CCGGCGCTCTATGGATGAATTGAATCTCGAGATTCAATTCATCCATAGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030722
VALIDATED
PUM1 MISSION shRNA shRNA Plasmid DNA
pumilio RNA-binding family member 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030722.1-2641s1c1
Sequence:CCGGGCTGGGCATATAATGGAATTTCTCGAGAAATTCCATTATATGCCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030722.1-457s1c1
Sequence:CCGGCGCTCTATGGATGAATTGAATCTCGAGATTCAATTCATCCATAGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030722.1-1756s1c1
Sequence:CCGGCCTGCTGCTTACTATGACCAACTCGAGTTGGTCATAGTAAGCAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030722.1-2763s1c1
Sequence:CCGGCCAACTTATGGTGGATGTGTTCTCGAGAACACATCCACCATAAGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102250    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030722.1-3880s1c1
Sequence:CCGGCCCTGCTGTTTACTGGTGTATCTCGAGATACACCAGTAAACAGCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030722.2-2793s21c1
Sequence:CCGGCCAACTTATGGTGGATGTGTTCTCGAGAACACATCCACCATAAGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294814    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030722.2-4171s21c1
Sequence:CCGGTGATCTCAAACTGGCATTTAACTCGAGTTAAATGCCAGTTTGAGATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030722.2-2671s21c1
Sequence:CCGGGCTGGGCATATAATGGAATTTCTCGAGAAATTCCATTATATGCCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030722.2-1786s21c1
Sequence:CCGGCCTGCTGCTTACTATGACCAACTCGAGTTGGTCATAGTAAGCAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030722.2-487s21c1
Sequence:CCGGCGCTCTATGGATGAATTGAATCTCGAGATTCAATTCATCCATAGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030722
VALIDATED
PUM1 MISSION shRNA Lentiviral Transduction Particles
pumilio RNA-binding family member 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030722.1-2641s1c1
Sequence:CCGGGCTGGGCATATAATGGAATTTCTCGAGAAATTCCATTATATGCCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030722.1-457s1c1
Sequence:CCGGCGCTCTATGGATGAATTGAATCTCGAGATTCAATTCATCCATAGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030722.1-1756s1c1
Sequence:CCGGCCTGCTGCTTACTATGACCAACTCGAGTTGGTCATAGTAAGCAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030722.1-2763s1c1
Sequence:CCGGCCAACTTATGGTGGATGTGTTCTCGAGAACACATCCACCATAAGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102250    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030722.1-3880s1c1
Sequence:CCGGCCCTGCTGTTTACTGGTGTATCTCGAGATACACCAGTAAACAGCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030722.2-2793s21c1
Sequence:CCGGCCAACTTATGGTGGATGTGTTCTCGAGAACACATCCACCATAAGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294814    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030722.2-4171s21c1
Sequence:CCGGTGATCTCAAACTGGCATTTAACTCGAGTTAAATGCCAGTTTGAGATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030722.2-2671s21c1
Sequence:CCGGGCTGGGCATATAATGGAATTTCTCGAGAAATTCCATTATATGCCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030722.2-1786s21c1
Sequence:CCGGCCTGCTGCTTACTATGACCAACTCGAGTTGGTCATAGTAAGCAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030722.2-487s21c1
Sequence:CCGGCGCTCTATGGATGAATTGAATCTCGAGATTCAATTCATCCATAGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)