EMAIL THIS PAGE TO A FRIEND

PURB

purine-rich element binding protein B

354 Gene Product Result for
Synonyms: PURBETA
UniProtKB ID: Q96QR8, A4D2L7
Gene ID:
Human(5814) Summary: This gene product is a sequence-specific, single-stranded DNA-binding protein. It binds preferentially to the single strand of the purine-rich element termed PUR, which is present at origins of replication and in gene flanking regions in a variety of eukaryotes from yeasts through humans. Thus, it is implicated in the control of both DNA replication and transcription. Deletion of this gene has been associated with myelodysplastic syndrome and acute myelogenous leukemia. [provided by RefSeq, Jul 2008]
Mouse(19291) purine rich element binding protein B
Rat(498407) purine rich element binding protein B
chicken(430546) purine-rich element binding protein B
domestic cat(101099868) purine-rich element binding protein B
cow(504276) purine-rich element binding protein B
sheep(101117840) purine-rich element binding protein B
naked mole-rat(101713182) purine-rich element binding protein B
domestic guinea pig(100716526) purine-rich element binding protein B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033224 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033224 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033224 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011221 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011221 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011221 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033224 Rosetta Predictions human pricing
NM_001017503 Rosetta Predictions rat pricing
NM_011221 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033224 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173846 predicted 1305
2 SASI_Hs01_00173847 predicted 1181
3 SASI_Hs01_00173848 predicted 1246
4 SASI_Hs01_00173849 predicted 855
5 SASI_Hs01_00173850 predicted 1320
6 SASI_Hs02_00361023 predicted 1378
7 SASI_Hs01_00173852 predicted 1075
8 SASI_Hs01_00173853 predicted 1276
9 SASI_Hs01_00173854 predicted 1183
10 SASI_Hs01_00173855 predicted 1152
11 SASI_Hs01_00173851 predicted 1289
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017503 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00075294 predicted 953
2 SASI_Rn01_00075296 predicted 850
3 SASI_Rn01_00075297 predicted 1213
4 SASI_Rn01_00075298 predicted 1407
5 SASI_Rn01_00075299 predicted 1339
6 SASI_Rn02_00202326 predicted 802
7 SASI_Rn01_00075301 predicted 779
8 SASI_Rn01_00075302 predicted 789
9 SASI_Rn01_00075303 predicted 1346
10 SASI_Rn02_00202327 predicted 789
11 SASI_Rn01_00075295 predicted 410
12 SASI_Rn01_00075300 predicted 394
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011221 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00320174 predicted 867
2 SASI_Mm02_00320175 predicted 819
3 SASI_Mm02_00320176 predicted 867
4 SASI_Mm01_00039049 predicted 808
5 SASI_Mm01_00039050 predicted 815
6 SASI_Mm01_00039052 predicted 887
7 SASI_Mm01_00039053 predicted 876
8 SASI_Mm02_00320177 predicted 878
9 SASI_Mm01_00039056 predicted 886
10 SASI_Mm01_00039057 predicted 899
11 SASI_Mm01_00039048 predicted 926
12 SASI_Mm01_00039051 predicted 994
13 SASI_Mm01_00039054 predicted 1087
14 SASI_Mm01_00039055 predicted 988
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033224
PURB MISSION shRNA Bacterial Glycerol Stock
purine-rich element binding protein B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033224.3-571s21c1
Sequence:CCGGGGCGAAGCTCATAGACGACTACTCGAGTAGTCGTCTATGAGCTTCGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033224.3-3163s1c1
Sequence:CCGGGCGGAGAACAAATTCCTAAATCTCGAGATTTAGGAATTTGTTCTCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033224.3-875s1c1
Sequence:CCGGGATAAGCTTTATGAGCGACGTCTCGAGACGTCGCTCATAAAGCTTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033224.3-400s1c1
Sequence:CCGGCAAGTACTACCTGGACCTCAACTCGAGTTGAGGTCCAGGTAGTACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033224.3-833s1c1
Sequence:CCGGCGGTATGCGGATGAGATGAAACTCGAGTTTCATCTCATCCGCATACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033224.3-280s1c1
Sequence:CCGGCTTCATAGAACACTACGCGCACTCGAGTGCGCGTAGTGTTCTATGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033224.3-136s1c1
Sequence:CCGGCCAGAACAAGCGCTTCTACTTCTCGAGAAGTAGAAGCGCTTGTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033224.3-845s1c1
Sequence:CCGGGAGATGAAAGAAATCCAGGAACTCGAGTTCCTGGATTTCTTTCATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033224
PURB MISSION shRNA shRNA Plasmid DNA
purine-rich element binding protein B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033224.3-571s21c1
Sequence:CCGGGGCGAAGCTCATAGACGACTACTCGAGTAGTCGTCTATGAGCTTCGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033224.3-3163s1c1
Sequence:CCGGGCGGAGAACAAATTCCTAAATCTCGAGATTTAGGAATTTGTTCTCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033224.3-875s1c1
Sequence:CCGGGATAAGCTTTATGAGCGACGTCTCGAGACGTCGCTCATAAAGCTTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033224.3-400s1c1
Sequence:CCGGCAAGTACTACCTGGACCTCAACTCGAGTTGAGGTCCAGGTAGTACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033224.3-833s1c1
Sequence:CCGGCGGTATGCGGATGAGATGAAACTCGAGTTTCATCTCATCCGCATACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033224.3-280s1c1
Sequence:CCGGCTTCATAGAACACTACGCGCACTCGAGTGCGCGTAGTGTTCTATGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033224.3-136s1c1
Sequence:CCGGCCAGAACAAGCGCTTCTACTTCTCGAGAAGTAGAAGCGCTTGTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033224.3-845s1c1
Sequence:CCGGGAGATGAAAGAAATCCAGGAACTCGAGTTCCTGGATTTCTTTCATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033224
PURB MISSION shRNA Lentiviral Transduction Particles
purine-rich element binding protein B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033224.3-571s21c1
Sequence:CCGGGGCGAAGCTCATAGACGACTACTCGAGTAGTCGTCTATGAGCTTCGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033224.3-3163s1c1
Sequence:CCGGGCGGAGAACAAATTCCTAAATCTCGAGATTTAGGAATTTGTTCTCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033224.3-875s1c1
Sequence:CCGGGATAAGCTTTATGAGCGACGTCTCGAGACGTCGCTCATAAAGCTTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033224.3-400s1c1
Sequence:CCGGCAAGTACTACCTGGACCTCAACTCGAGTTGAGGTCCAGGTAGTACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033224.3-833s1c1
Sequence:CCGGCGGTATGCGGATGAGATGAAACTCGAGTTTCATCTCATCCGCATACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033224.3-280s1c1
Sequence:CCGGCTTCATAGAACACTACGCGCACTCGAGTGCGCGTAGTGTTCTATGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033224.3-136s1c1
Sequence:CCGGCCAGAACAAGCGCTTCTACTTCTCGAGAAGTAGAAGCGCTTGTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033224.3-845s1c1
Sequence:CCGGGAGATGAAAGAAATCCAGGAACTCGAGTTCCTGGATTTCTTTCATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011221
VALIDATED
PURB MISSION shRNA Bacterial Glycerol Stock
purine-rich element binding protein B
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011221.2-816s21c1
Sequence:CCGGTGAAGCCGTCCTACCGCAATGCTCGAGCATTGCGGTAGGACGGCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011221.2-745s21c1
Sequence:CCGGCGTGGACTCGAAGCGCTTCTTCTCGAGAAGAAGCGCTTCGAGTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011221.2-887s21c1
Sequence:CCGGCGGTATGCAGATGAAATGAAACTCGAGTTTCATTTCATCTGCATACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011221.2-445s21c1
Sequence:CCGGCGAGAACCGCAAGTACTACCTCTCGAGAGGTAGTACTTGCGGTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011221.2-919s21c1
Sequence:CCGGGCGACAGAGGGATAAGCTTTACTCGAGTAAAGCTTATCCCTCTGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011221.1-895s1c1
Sequence:CCGGTGCAGATGAAATGAAAGAGATCTCGAGATCTCTTTCATTTCATCTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011221.1-890s1c1
Sequence:CCGGCGGTATGCAGATGAAATGAAACTCGAGTTTCATTTCATCTGCATACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011221.1-835s1c1
Sequence:CCGGCAATGCCATCACCGTGCCCTTCTCGAGAAGGGCACGGTGATGGCATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011221.1-922s1c1
Sequence:CCGGGCGACAGAGGGATAAGCTTTACTCGAGTAAAGCTTATCCCTCTGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011221.1-748s1c1
Sequence:CCGGCGTGGACTCGAAGCGCTTCTTCTCGAGAAGAAGCGCTTCGAGTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011221
VALIDATED
PURB MISSION shRNA shRNA Plasmid DNA
purine-rich element binding protein B
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011221.2-816s21c1
Sequence:CCGGTGAAGCCGTCCTACCGCAATGCTCGAGCATTGCGGTAGGACGGCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011221.2-745s21c1
Sequence:CCGGCGTGGACTCGAAGCGCTTCTTCTCGAGAAGAAGCGCTTCGAGTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011221.2-887s21c1
Sequence:CCGGCGGTATGCAGATGAAATGAAACTCGAGTTTCATTTCATCTGCATACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011221.2-445s21c1
Sequence:CCGGCGAGAACCGCAAGTACTACCTCTCGAGAGGTAGTACTTGCGGTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011221.2-919s21c1
Sequence:CCGGGCGACAGAGGGATAAGCTTTACTCGAGTAAAGCTTATCCCTCTGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011221.1-895s1c1
Sequence:CCGGTGCAGATGAAATGAAAGAGATCTCGAGATCTCTTTCATTTCATCTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011221.1-890s1c1
Sequence:CCGGCGGTATGCAGATGAAATGAAACTCGAGTTTCATTTCATCTGCATACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011221.1-835s1c1
Sequence:CCGGCAATGCCATCACCGTGCCCTTCTCGAGAAGGGCACGGTGATGGCATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011221.1-922s1c1
Sequence:CCGGGCGACAGAGGGATAAGCTTTACTCGAGTAAAGCTTATCCCTCTGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011221.1-748s1c1
Sequence:CCGGCGTGGACTCGAAGCGCTTCTTCTCGAGAAGAAGCGCTTCGAGTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011221
VALIDATED
PURB MISSION shRNA Lentiviral Transduction Particles
purine-rich element binding protein B
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011221.2-816s21c1
Sequence:CCGGTGAAGCCGTCCTACCGCAATGCTCGAGCATTGCGGTAGGACGGCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011221.2-745s21c1
Sequence:CCGGCGTGGACTCGAAGCGCTTCTTCTCGAGAAGAAGCGCTTCGAGTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011221.2-887s21c1
Sequence:CCGGCGGTATGCAGATGAAATGAAACTCGAGTTTCATTTCATCTGCATACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011221.2-445s21c1
Sequence:CCGGCGAGAACCGCAAGTACTACCTCTCGAGAGGTAGTACTTGCGGTTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011221.2-919s21c1
Sequence:CCGGGCGACAGAGGGATAAGCTTTACTCGAGTAAAGCTTATCCCTCTGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011221.1-895s1c1
Sequence:CCGGTGCAGATGAAATGAAAGAGATCTCGAGATCTCTTTCATTTCATCTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011221.1-890s1c1
Sequence:CCGGCGGTATGCAGATGAAATGAAACTCGAGTTTCATTTCATCTGCATACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011221.1-835s1c1
Sequence:CCGGCAATGCCATCACCGTGCCCTTCTCGAGAAGGGCACGGTGATGGCATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011221.1-922s1c1
Sequence:CCGGGCGACAGAGGGATAAGCTTTACTCGAGTAAAGCTTATCCCTCTGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011221.1-748s1c1
Sequence:CCGGCGTGGACTCGAAGCGCTTCTTCTCGAGAAGAAGCGCTTCGAGTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)