EMAIL THIS PAGE TO A FRIEND

PUS10

pseudouridylate synthase 10

91 Gene Product Result for
Synonyms: CCDC139 DOBI
UniProtKB ID: Q3MIT2, Q5JPJ5, Q96MI8
Gene ID:
Human(150962) Summary: Pseudouridination, the isomerization of uridine to pseudouridine, is the most common posttranscriptional nucleotide modification found in RNA and is essential for biologic functions such as spliceosome biogenesis. Pseudouridylate synthases, such as PUS10, catalyze pseudouridination of structural RNAs, including transfer, ribosomal, and splicing RNAs. These enzymes also act as RNA chaperones, facilitating the correct folding and assembly of tRNAs (McCleverty et al., 2007 [PubMed 17900615]
Mouse(74467) pseudouridylate synthase 10
Rat(305583) pseudouridylate synthase 10
domestic guinea pig(100719404) pseudouridylate synthase 10
naked mole-rat(101699684) pseudouridylate synthase 10
cow(614986) pseudouridylate synthase 10
sheep(101118346) pseudouridylate synthase 10
Zebrafish(566689) pseudouridylate synthase 10
domestic cat(101099794) pseudouridylate synthase 10
Horse(100052053) pseudouridylate synthase 10
dog(481383) pseudouridylate synthase 10
chicken(421198) pseudouridylate synthase 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144709 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144709 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144709 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028956 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028956 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028956 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144709 Rosetta Predictions human pricing
NM_001025278 Rosetta Predictions rat pricing
NM_001033654 Rosetta Predictions mouse pricing
NM_028304 Rosetta Predictions mouse pricing
NM_028956 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144709 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00364648 predicted 1471
2 SASI_Hs01_00212680 predicted 1044
3 SASI_Hs01_00212681 predicted 353
4 SASI_Hs01_00212682 predicted 1591
5 SASI_Hs01_00212683 predicted 984
6 SASI_Hs01_00212684 predicted 1309
7 SASI_Hs01_00212685 predicted 1748
8 SASI_Hs01_00212687 predicted 757
9 SASI_Hs01_00212688 predicted 339
10 SASI_Hs01_00212689 predicted 1163
11 SASI_Hs01_00212686 predicted 311
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025278 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00112011 predicted 773
2 SASI_Rn01_00112012 predicted 1079
3 SASI_Rn01_00112013 predicted 568
4 SASI_Rn01_00112014 predicted 955
5 SASI_Rn01_00112015 predicted 476
6 SASI_Rn01_00112016 predicted 1074
7 SASI_Rn01_00112017 predicted 811
8 SASI_Rn01_00112018 predicted 754
9 SASI_Rn01_00112019 predicted 486
10 SASI_Rn01_00112020 predicted 546
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033654 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151179 predicted 299
2 SASI_Mm01_00151180 predicted 618
3 SASI_Mm01_00151182 predicted 1363
4 SASI_Mm02_00288959 predicted 851
5 SASI_Mm01_00151184 predicted 968
6 SASI_Mm01_00151185 predicted 814
7 SASI_Mm01_00151187 predicted 475
8 SASI_Mm01_00151188 predicted 786
9 SASI_Mm02_00288960 predicted 590
10 SASI_Mm02_00288961 predicted 1516
11 SASI_Mm01_00151181 predicted 1543
12 SASI_Mm01_00151183 predicted 1558
13 SASI_Mm01_00151186 predicted 1299
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028304 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172605 predicted 711
2 SASI_Mm01_00172606 predicted 1031
3 SASI_Mm01_00172608 predicted 1774
4 SASI_Mm02_00333653 predicted 1262
5 SASI_Mm01_00172610 predicted 1382
6 SASI_Mm01_00172611 predicted 1227
7 SASI_Mm01_00172613 predicted 887
8 SASI_Mm01_00172614 predicted 1201
9 SASI_Mm02_00333654 predicted 1009
10 SASI_Mm02_00333655 predicted 1926
11 SASI_Mm01_00172607 predicted 1959
12 SASI_Mm01_00172609 predicted 1969
13 SASI_Mm01_00172612 predicted 1711
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028956 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00140517 predicted 308
2 SASI_Mm01_00140518 predicted 632
3 SASI_Mm01_00140520 predicted 1370
4 SASI_Mm02_00334681 predicted 859
5 SASI_Mm01_00140522 predicted 976
6 SASI_Mm01_00140523 predicted 829
7 SASI_Mm01_00140525 predicted 483
8 SASI_Mm01_00140526 predicted 798
9 SASI_Mm02_00334682 predicted 599
10 SASI_Mm02_00334683 predicted 1520
11 SASI_Mm01_00140519 predicted 1557
12 SASI_Mm01_00140521 predicted 1566
13 SASI_Mm01_00140524 predicted 1314
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144709
PUS10 MISSION shRNA Bacterial Glycerol Stock
pseudouridylate synthase 10
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138642    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144709.1-1756s1c1
Sequence:CCGGCCACCATAACGGTGTCTTGAACTCGAGTTCAAGACACCGTTATGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144709.1-1618s1c1
Sequence:CCGGGAGCTGGATGTTGAGTCTGTACTCGAGTACAGACTCAACATCCAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144709.1-1348s1c1
Sequence:CCGGGCGATACAGAAGAAAGACATTCTCGAGAATGTCTTTCTTCTGTATCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144709.1-702s1c1
Sequence:CCGGGCTTGAAGTGAGTGTGGTCTTCTCGAGAAGACCACACTCACTTCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134616    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144709.1-1816s1c1
Sequence:CCGGGTTGTAACATCTCAGGATCTACTCGAGTAGATCCTGAGATGTTACAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144709.1-1162s1c1
Sequence:CCGGGTGAATCCTCATAGAGTACATCTCGAGATGTACTCTATGAGGATTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144709.2-906s21c1
Sequence:CCGGGCCACTTCCTAGCTGCGATATCTCGAGATATCGCAGCTAGGAAGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144709.2-967s21c1
Sequence:CCGGATTCACTAGAATGGCAGTTATCTCGAGATAACTGCCATTCTAGTGAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414669    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144709.2-2259s21c1
Sequence:CCGGATGCAGCATAATATCCTATAACTCGAGTTATAGGATATTATGCTGCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144709.2-536s21c1
Sequence:CCGGGCTTCCAAGAACTCAAATTTACTCGAGTAAATTTGAGTTCTTGGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144709
PUS10 MISSION shRNA shRNA Plasmid DNA
pseudouridylate synthase 10
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138642    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144709.1-1756s1c1
Sequence:CCGGCCACCATAACGGTGTCTTGAACTCGAGTTCAAGACACCGTTATGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144709.1-1618s1c1
Sequence:CCGGGAGCTGGATGTTGAGTCTGTACTCGAGTACAGACTCAACATCCAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144709.1-1348s1c1
Sequence:CCGGGCGATACAGAAGAAAGACATTCTCGAGAATGTCTTTCTTCTGTATCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144709.1-702s1c1
Sequence:CCGGGCTTGAAGTGAGTGTGGTCTTCTCGAGAAGACCACACTCACTTCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134616    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144709.1-1816s1c1
Sequence:CCGGGTTGTAACATCTCAGGATCTACTCGAGTAGATCCTGAGATGTTACAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144709.1-1162s1c1
Sequence:CCGGGTGAATCCTCATAGAGTACATCTCGAGATGTACTCTATGAGGATTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144709.2-906s21c1
Sequence:CCGGGCCACTTCCTAGCTGCGATATCTCGAGATATCGCAGCTAGGAAGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144709.2-967s21c1
Sequence:CCGGATTCACTAGAATGGCAGTTATCTCGAGATAACTGCCATTCTAGTGAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414669    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144709.2-2259s21c1
Sequence:CCGGATGCAGCATAATATCCTATAACTCGAGTTATAGGATATTATGCTGCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144709.2-536s21c1
Sequence:CCGGGCTTCCAAGAACTCAAATTTACTCGAGTAAATTTGAGTTCTTGGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144709
PUS10 MISSION shRNA Lentiviral Transduction Particles
pseudouridylate synthase 10
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138642    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144709.1-1756s1c1
Sequence:CCGGCCACCATAACGGTGTCTTGAACTCGAGTTCAAGACACCGTTATGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144709.1-1618s1c1
Sequence:CCGGGAGCTGGATGTTGAGTCTGTACTCGAGTACAGACTCAACATCCAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144709.1-1348s1c1
Sequence:CCGGGCGATACAGAAGAAAGACATTCTCGAGAATGTCTTTCTTCTGTATCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144709.1-702s1c1
Sequence:CCGGGCTTGAAGTGAGTGTGGTCTTCTCGAGAAGACCACACTCACTTCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134616    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144709.1-1816s1c1
Sequence:CCGGGTTGTAACATCTCAGGATCTACTCGAGTAGATCCTGAGATGTTACAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144709.1-1162s1c1
Sequence:CCGGGTGAATCCTCATAGAGTACATCTCGAGATGTACTCTATGAGGATTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144709.2-906s21c1
Sequence:CCGGGCCACTTCCTAGCTGCGATATCTCGAGATATCGCAGCTAGGAAGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144709.2-967s21c1
Sequence:CCGGATTCACTAGAATGGCAGTTATCTCGAGATAACTGCCATTCTAGTGAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414669    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144709.2-2259s21c1
Sequence:CCGGATGCAGCATAATATCCTATAACTCGAGTTATAGGATATTATGCTGCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144709.2-536s21c1
Sequence:CCGGGCTTCCAAGAACTCAAATTTACTCGAGTAAATTTGAGTTCTTGGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028956
VALIDATED
PUS10 MISSION shRNA Bacterial Glycerol Stock
pseudouridylate synthase 10
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000190123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028956.1-1150s1c1
Sequence:CCGGCGAGTGCATTTCACCTCACAACTCGAGTTGTGAGGTGAAATGCACTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028956.1-1350s1c1
Sequence:CCGGCCTGGACGACTTAAAGGACTTCTCGAGAAGTCCTTTAAGTCGTCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028956.1-322s1c1
Sequence:CCGGGAGGGAGTCTCTGTTACTGAACTCGAGTTCAGTAACAGAGACTCCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216556    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028956.4-1822s1c1
Sequence:CCGGGATCTATTTGTACGCATATTTCTCGAGAAATATGCGTACAAATAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028956.4-1520s1c1
Sequence:CCGGCCAAGCTGGAACCTACATTAACTCGAGTTAATGTAGGTTCCAGCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241410    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028956.4-1822s21c1
Sequence:CCGGGATCTATTTGTACGCATATTTCTCGAGAAATATGCGTACAAATAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028956.4-1520s21c1
Sequence:CCGGCCAAGCTGGAACCTACATTAACTCGAGTTAATGTAGGTTCCAGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028956.4-946s21c1
Sequence:CCGGTTGTCGCTGGCAGATATAATACTCGAGTATTATATCTGCCAGCGACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028956.4-1366s21c1
Sequence:CCGGTTGGGTTCCTGGACGACTTAACTCGAGTTAAGTCGTCCAGGAACCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028956.4-145s21c1
Sequence:CCGGCCTGTCCAAGATGCATCTTAACTCGAGTTAAGATGCATCTTGGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028956
VALIDATED
PUS10 MISSION shRNA shRNA Plasmid DNA
pseudouridylate synthase 10
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000190123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028956.1-1150s1c1
Sequence:CCGGCGAGTGCATTTCACCTCACAACTCGAGTTGTGAGGTGAAATGCACTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028956.1-1350s1c1
Sequence:CCGGCCTGGACGACTTAAAGGACTTCTCGAGAAGTCCTTTAAGTCGTCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028956.1-322s1c1
Sequence:CCGGGAGGGAGTCTCTGTTACTGAACTCGAGTTCAGTAACAGAGACTCCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216556    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028956.4-1822s1c1
Sequence:CCGGGATCTATTTGTACGCATATTTCTCGAGAAATATGCGTACAAATAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028956.4-1520s1c1
Sequence:CCGGCCAAGCTGGAACCTACATTAACTCGAGTTAATGTAGGTTCCAGCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241410    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028956.4-1822s21c1
Sequence:CCGGGATCTATTTGTACGCATATTTCTCGAGAAATATGCGTACAAATAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028956.4-1520s21c1
Sequence:CCGGCCAAGCTGGAACCTACATTAACTCGAGTTAATGTAGGTTCCAGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028956.4-946s21c1
Sequence:CCGGTTGTCGCTGGCAGATATAATACTCGAGTATTATATCTGCCAGCGACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028956.4-1366s21c1
Sequence:CCGGTTGGGTTCCTGGACGACTTAACTCGAGTTAAGTCGTCCAGGAACCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028956.4-145s21c1
Sequence:CCGGCCTGTCCAAGATGCATCTTAACTCGAGTTAAGATGCATCTTGGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028956
VALIDATED
PUS10 MISSION shRNA Lentiviral Transduction Particles
pseudouridylate synthase 10
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000190123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028956.1-1150s1c1
Sequence:CCGGCGAGTGCATTTCACCTCACAACTCGAGTTGTGAGGTGAAATGCACTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028956.1-1350s1c1
Sequence:CCGGCCTGGACGACTTAAAGGACTTCTCGAGAAGTCCTTTAAGTCGTCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028956.1-322s1c1
Sequence:CCGGGAGGGAGTCTCTGTTACTGAACTCGAGTTCAGTAACAGAGACTCCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216556    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028956.4-1822s1c1
Sequence:CCGGGATCTATTTGTACGCATATTTCTCGAGAAATATGCGTACAAATAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028956.4-1520s1c1
Sequence:CCGGCCAAGCTGGAACCTACATTAACTCGAGTTAATGTAGGTTCCAGCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241410    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028956.4-1822s21c1
Sequence:CCGGGATCTATTTGTACGCATATTTCTCGAGAAATATGCGTACAAATAGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028956.4-1520s21c1
Sequence:CCGGCCAAGCTGGAACCTACATTAACTCGAGTTAATGTAGGTTCCAGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028956.4-946s21c1
Sequence:CCGGTTGTCGCTGGCAGATATAATACTCGAGTATTATATCTGCCAGCGACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028956.4-1366s21c1
Sequence:CCGGTTGGGTTCCTGGACGACTTAACTCGAGTTAAGTCGTCCAGGAACCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028956.4-145s21c1
Sequence:CCGGCCTGTCCAAGATGCATCTTAACTCGAGTTAAGATGCATCTTGGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)