EMAIL THIS PAGE TO A FRIEND

PUS1

pseudouridylate synthase 1

99 Gene Product Result for
Synonyms: MLASA1
UniProtKB ID: Q9Y606, A8K877, B3KQC1, Q8WYT2, Q9BU44
Gene ID:
Human(80324) Summary: This gene encodes a pseudouridine synthase that converts uridine to pseudouridine once it has been incorporated into an RNA molecule. The encoded enzyme may play an essential role in tRNA function and in stabilizing the secondary and tertiary structure of many RNAs. A mutation in this gene has been linked to mitochondrial myopathy and sideroblastic anemia. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Sep 2009]
Mouse(56361) pseudouridine synthase 1
Rat(304567) pseudouridylate synthase 1
Zebrafish(494060) pseudouridine synthase 1
dog(609867) pseudouridylate synthase 1
domestic cat(101098405) pseudouridylate synthase 1
chicken(416799) pseudouridylate synthase 1
cow(515808) pseudouridylate synthase 1
sheep(100302353) pseudouridylate synthase 1
naked mole-rat(101715184) pseudouridylate synthase 1
domestic guinea pig(100719453) pseudouridylate synthase 1
Gene Class: Dehydratase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019700 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019700 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019700 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_025215 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025215 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025215 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002019 Rosetta Predictions human pricing
NM_001002020 Rosetta Predictions human pricing
NM_025215 Rosetta Predictions human pricing
NM_001025563 Rosetta Predictions rat pricing
NM_001025561 Rosetta Predictions mouse pricing
NM_001025562 Rosetta Predictions mouse pricing
NM_019700 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002019 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241396 predicted 868
2 SASI_Hs01_00241400 predicted 390
3 SASI_Hs02_00304080 predicted 387
4 SASI_Hs02_00304081 predicted 941
5 SASI_Hs02_00304082 predicted 384
6 SASI_Hs01_00241397 predicted 696
7 SASI_Hs01_00241398 predicted 790
8 SASI_Hs01_00241399 predicted 1178
9 SASI_Hs01_00241401 predicted 564
10 SASI_Hs01_00241402 predicted 601
11 SASI_Hs01_00241403 predicted 1354
12 SASI_Hs01_00241404 predicted 1275
13 SASI_Hs01_00241405 predicted 1126
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002020 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087260 predicted 835
2 SASI_Hs01_00087264 predicted 358
3 SASI_Hs02_00304083 predicted 362
4 SASI_Hs02_00304084 predicted 923
5 SASI_Hs02_00304085 predicted 365
6 SASI_Hs01_00087261 predicted 676
7 SASI_Hs01_00087262 predicted 766
8 SASI_Hs01_00087263 predicted 1158
9 SASI_Hs01_00087265 predicted 541
10 SASI_Hs01_00087266 predicted 575
11 SASI_Hs01_00087267 predicted 1331
12 SASI_Hs01_00087268 predicted 1252
13 SASI_Hs01_00087269 predicted 1109
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025215 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199276 predicted 1255
2 SASI_Hs01_00199280 predicted 778
3 SASI_Hs02_00358001 predicted 782
4 SASI_Hs02_00358002 predicted 1336
5 SASI_Hs02_00358003 predicted 775
6 SASI_Hs01_00199277 predicted 1092
7 SASI_Hs01_00199278 predicted 1188
8 SASI_Hs01_00199279 predicted 1576
9 SASI_Hs01_00199281 predicted 956
10 SASI_Hs01_00199282 predicted 986
11 SASI_Hs01_00199283 predicted 1749
12 SASI_Hs01_00199284 predicted 1674
13 SASI_Hs01_00199285 predicted 1518
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025563 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087396 predicted 856
2 SASI_Rn01_00087397 predicted 951
3 SASI_Rn01_00087398 predicted 1265
4 SASI_Rn01_00087399 predicted 712
5 SASI_Rn02_00203174 predicted 755
6 SASI_Rn01_00087400 predicted 1018
7 SASI_Rn01_00087401 predicted 837
8 SASI_Rn01_00087402 predicted 574
9 SASI_Rn01_00087403 predicted 1238
10 SASI_Rn01_00087404 predicted 1254
11 SASI_Rn01_00087405 predicted 905
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025561 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00072730 predicted 1509
2 SASI_Mm01_00072731 predicted 1031
3 SASI_Mm01_00072732 predicted 978
4 SASI_Mm01_00072733 predicted 1554
5 SASI_Mm01_00072734 predicted 1417
6 SASI_Mm01_00072735 predicted 1093
7 SASI_Mm01_00072736 predicted 1494
8 SASI_Mm01_00072737 predicted 1119
9 SASI_Mm01_00072738 predicted 1040
10 SASI_Mm01_00072739 predicted 1486
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025562 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00148735 predicted 1148
2 SASI_Mm02_00287900 predicted 449
3 SASI_Mm01_00148736 predicted 665
4 SASI_Mm02_00287901 predicted 1065
5 SASI_Mm02_00287902 predicted 1051
6 SASI_Mm01_00148737 predicted 622
7 SASI_Mm02_00287903 predicted 345
8 SASI_Mm02_00287904 predicted 372
9 SASI_Mm02_00287905 predicted 659
10 SASI_Mm01_00148738 predicted 1201
11 SASI_Mm01_00148739 predicted 1067
12 SASI_Mm01_00148740 predicted 743
13 SASI_Mm01_00148741 predicted 1143
14 SASI_Mm01_00148742 predicted 764
15 SASI_Mm01_00148743 predicted 689
16 SASI_Mm01_00148744 predicted 1128
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019700 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00024962 predicted 1449
2 SASI_Mm01_00024963 predicted 976
3 SASI_Mm01_00024964 predicted 917
4 SASI_Mm01_00024965 predicted 1498
5 SASI_Mm01_00024966 predicted 1355
6 SASI_Mm01_00024967 predicted 1044
7 SASI_Mm01_00024968 predicted 1441
8 SASI_Mm01_00024969 predicted 1060
9 SASI_Mm01_00024970 predicted 985
10 SASI_Mm01_00024971 predicted 1433
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019700
VALIDATED
PUS1 MISSION shRNA Bacterial Glycerol Stock
pseudouridylate synthase 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000322533    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019700.4-1663s21c1
Sequence:CCGGGCTTCATAACCTCAGGATATTCTCGAGAATATCCTGAGGTTATGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019700.4-623s21c1
Sequence:CCGGTTAGTCCAGGCAGGTTGTATCCTCGAGGATACAACCTGCCTGGACTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019700.4-976s21c1
Sequence:CCGGCTGCTACAAAGGCACCCATAACTCGAGTTATGGGTGCCTTTGTAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019700.4-1170s21c1
Sequence:CCGGTAGCCATTGTGAAGGGTTATGCTCGAGCATAACCCTTCACAATGGCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019700.4-1365s21c1
Sequence:CCGGCTTTCAAGGAGCAGTACATTTCTCGAGAAATGTACTGCTCCTTGAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120142    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019700.3-1682s1c1
Sequence:CCGGGCTTCATAACCTCAGGATATTCTCGAGAATATCCTGAGGTTATGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019700.3-380s1c1
Sequence:CCGGGCCGCCTATGGCTGGAAACAACTCGAGTTGTTTCCAGCCATAGGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019700.3-1019s1c1
Sequence:CCGGCCATAACTTCACCTCGCAGAACTCGAGTTCTGCGAGGTGAAGTTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019700.3-1394s1c1
Sequence:CCGGGCAGTACATTTACCCTACCATCTCGAGATGGTAGGGTAAATGTACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019700.3-1064s1c1
Sequence:CCGGCCGCTACATTCTGGAGATGTACTCGAGTACATCTCCAGAATGTAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019700
VALIDATED
PUS1 MISSION shRNA shRNA Plasmid DNA
pseudouridylate synthase 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000322533    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019700.4-1663s21c1
Sequence:CCGGGCTTCATAACCTCAGGATATTCTCGAGAATATCCTGAGGTTATGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019700.4-623s21c1
Sequence:CCGGTTAGTCCAGGCAGGTTGTATCCTCGAGGATACAACCTGCCTGGACTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019700.4-976s21c1
Sequence:CCGGCTGCTACAAAGGCACCCATAACTCGAGTTATGGGTGCCTTTGTAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019700.4-1170s21c1
Sequence:CCGGTAGCCATTGTGAAGGGTTATGCTCGAGCATAACCCTTCACAATGGCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019700.4-1365s21c1
Sequence:CCGGCTTTCAAGGAGCAGTACATTTCTCGAGAAATGTACTGCTCCTTGAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120142    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019700.3-1682s1c1
Sequence:CCGGGCTTCATAACCTCAGGATATTCTCGAGAATATCCTGAGGTTATGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019700.3-380s1c1
Sequence:CCGGGCCGCCTATGGCTGGAAACAACTCGAGTTGTTTCCAGCCATAGGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019700.3-1019s1c1
Sequence:CCGGCCATAACTTCACCTCGCAGAACTCGAGTTCTGCGAGGTGAAGTTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019700.3-1394s1c1
Sequence:CCGGGCAGTACATTTACCCTACCATCTCGAGATGGTAGGGTAAATGTACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019700.3-1064s1c1
Sequence:CCGGCCGCTACATTCTGGAGATGTACTCGAGTACATCTCCAGAATGTAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019700
VALIDATED
PUS1 MISSION shRNA Lentiviral Transduction Particles
pseudouridylate synthase 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000322533    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019700.4-1663s21c1
Sequence:CCGGGCTTCATAACCTCAGGATATTCTCGAGAATATCCTGAGGTTATGAAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000322467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019700.4-623s21c1
Sequence:CCGGTTAGTCCAGGCAGGTTGTATCCTCGAGGATACAACCTGCCTGGACTAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000322465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019700.4-976s21c1
Sequence:CCGGCTGCTACAAAGGCACCCATAACTCGAGTTATGGGTGCCTTTGTAGCAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000322535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019700.4-1170s21c1
Sequence:CCGGTAGCCATTGTGAAGGGTTATGCTCGAGCATAACCCTTCACAATGGCTATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000322537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019700.4-1365s21c1
Sequence:CCGGCTTTCAAGGAGCAGTACATTTCTCGAGAAATGTACTGCTCCTTGAAAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000120142    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019700.3-1682s1c1
Sequence:CCGGGCTTCATAACCTCAGGATATTCTCGAGAATATCCTGAGGTTATGAAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000120145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019700.3-380s1c1
Sequence:CCGGGCCGCCTATGGCTGGAAACAACTCGAGTTGTTTCCAGCCATAGGCGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000120146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019700.3-1019s1c1
Sequence:CCGGCCATAACTTCACCTCGCAGAACTCGAGTTCTGCGAGGTGAAGTTATGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000120143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019700.3-1394s1c1
Sequence:CCGGGCAGTACATTTACCCTACCATCTCGAGATGGTAGGGTAAATGTACTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000120144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019700.3-1064s1c1
Sequence:CCGGCCGCTACATTCTGGAGATGTACTCGAGTACATCTCCAGAATGTAGCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025215
VALIDATED
PUS1 MISSION shRNA Bacterial Glycerol Stock
pseudouridylate synthase 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_025215.4-1201s21c1
Sequence:CCGGGCACGCACAACTTCCACAATTCTCGAGAATTGTGGAAGTTGTGCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_025215.4-788s21c1
Sequence:CCGGTGTCGGGTCCTCACAATTCAACTCGAGTTGAATTGTGAGGACCCGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_025215.4-1493s21c1
Sequence:CCGGGCACTTCGAGAAGTACAACCACTCGAGTGGTTGTACTTCTCGAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_025215.4-1340s21c1
Sequence:CCGGGAGCTTCATGATGCATCAGATCTCGAGATCTGATGCATCATGAAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025215.3-948s1c1
Sequence:CCGGGCACGCACAACTTCCACAATTCTCGAGAATTGTGGAAGTTGTGCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025215.3-409s1c1
Sequence:CCGGCGGAGAACATCCGGCGAAGAACTCGAGTTCTTCGCCGGATGTTCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_025215.3-1087s1c1
Sequence:CCGGGAGCTTCATGATGCATCAGATCTCGAGATCTGATGCATCATGAAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_025215.3-1240s1c1
Sequence:CCGGGCACTTCGAGAAGTACAACCACTCGAGTGGTTGTACTTCTCGAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_025215.3-535s1c1
Sequence:CCGGTGTCGGGTCCTCACAATTCAACTCGAGTTGAATTGTGAGGACCCGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025215
VALIDATED
PUS1 MISSION shRNA shRNA Plasmid DNA
pseudouridylate synthase 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_025215.4-1201s21c1
Sequence:CCGGGCACGCACAACTTCCACAATTCTCGAGAATTGTGGAAGTTGTGCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_025215.4-788s21c1
Sequence:CCGGTGTCGGGTCCTCACAATTCAACTCGAGTTGAATTGTGAGGACCCGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_025215.4-1493s21c1
Sequence:CCGGGCACTTCGAGAAGTACAACCACTCGAGTGGTTGTACTTCTCGAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_025215.4-1340s21c1
Sequence:CCGGGAGCTTCATGATGCATCAGATCTCGAGATCTGATGCATCATGAAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025215.3-948s1c1
Sequence:CCGGGCACGCACAACTTCCACAATTCTCGAGAATTGTGGAAGTTGTGCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025215.3-409s1c1
Sequence:CCGGCGGAGAACATCCGGCGAAGAACTCGAGTTCTTCGCCGGATGTTCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_025215.3-1087s1c1
Sequence:CCGGGAGCTTCATGATGCATCAGATCTCGAGATCTGATGCATCATGAAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_025215.3-1240s1c1
Sequence:CCGGGCACTTCGAGAAGTACAACCACTCGAGTGGTTGTACTTCTCGAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_025215.3-535s1c1
Sequence:CCGGTGTCGGGTCCTCACAATTCAACTCGAGTTGAATTGTGAGGACCCGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025215
VALIDATED
PUS1 MISSION shRNA Lentiviral Transduction Particles
pseudouridylate synthase 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_025215.4-1201s21c1
Sequence:CCGGGCACGCACAACTTCCACAATTCTCGAGAATTGTGGAAGTTGTGCGTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000300402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_025215.4-788s21c1
Sequence:CCGGTGTCGGGTCCTCACAATTCAACTCGAGTTGAATTGTGAGGACCCGACATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000300403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_025215.4-1493s21c1
Sequence:CCGGGCACTTCGAGAAGTACAACCACTCGAGTGGTTGTACTTCTCGAAGTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000300401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_025215.4-1340s21c1
Sequence:CCGGGAGCTTCATGATGCATCAGATCTCGAGATCTGATGCATCATGAAGCTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000045513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025215.3-948s1c1
Sequence:CCGGGCACGCACAACTTCCACAATTCTCGAGAATTGTGGAAGTTGTGCGTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000045514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025215.3-409s1c1
Sequence:CCGGCGGAGAACATCCGGCGAAGAACTCGAGTTCTTCGCCGGATGTTCTCCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000045515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_025215.3-1087s1c1
Sequence:CCGGGAGCTTCATGATGCATCAGATCTCGAGATCTGATGCATCATGAAGCTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000045517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_025215.3-1240s1c1
Sequence:CCGGGCACTTCGAGAAGTACAACCACTCGAGTGGTTGTACTTCTCGAAGTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000045516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_025215.3-535s1c1
Sequence:CCGGTGTCGGGTCCTCACAATTCAACTCGAGTTGAATTGTGAGGACCCGACATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???