EMAIL THIS PAGE TO A FRIEND

PUS3

pseudouridylate synthase 3

56 Gene Product Result for
Synonyms: 2610020J05Rik
UniProtKB ID: Q9BZE2, B2RAM0, Q96D17, Q96J23, Q96NB4
Gene ID:
Human(83480) Summary: The protein encoded by this gene catalyzes the formation of tRNA pseudouridine from tRNA uridine at position 39 in the anticodon stem and loop of transfer RNAs. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
Mouse(67049) pseudouridine synthase 3
Rat(315554) pseudouridylate synthase 3
Zebrafish(337487) pseudouridylate synthase 3
Horse(100064416) pseudouridylate synthase 3
domestic cat(101086499) pseudouridylate synthase 3
dog(479397) pseudouridylate synthase 3
chicken(419708) pseudouridylate synthase 3
cow(515824) pseudouridylate synthase 3
sheep(101112522) pseudouridylate synthase 3
naked mole-rat(101708971) pseudouridylate synthase 3
domestic guinea pig(100717478) pseudouridylate synthase 3
Gene Class: Dehydratase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023292 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023292 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023292 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031307 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031307 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031307 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031307 Rosetta Predictions human pricing
NM_001108134 Rosetta Predictions rat pricing
NM_023292 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031307 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161235 predicted 1302
2 SASI_Hs01_00161236 predicted 740
3 SASI_Hs01_00161237 predicted 1014
4 SASI_Hs01_00161238 predicted 853
5 SASI_Hs01_00161239 predicted 464
6 SASI_Hs01_00161240 predicted 1220
7 SASI_Hs01_00161241 predicted 1051
8 SASI_Hs01_00161242 predicted 1162
9 SASI_Hs01_00161243 predicted 927
10 SASI_Hs01_00161244 predicted 1333
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108134 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235694 predicted 446
2 SASI_Rn02_00235695 predicted 989
3 SASI_Rn02_00235696 predicted 644
4 SASI_Rn02_00235697 predicted 495
5 SASI_Rn02_00235698 predicted 684
6 SASI_Rn02_00235699 predicted 1064
7 SASI_Rn02_00235700 predicted 208
8 SASI_Rn02_00235701 predicted 667
9 SASI_Rn02_00235702 predicted 733
10 SASI_Rn02_00235703 predicted 349
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023292 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043958 predicted 1400
2 SASI_Mm01_00043959 predicted 1087
3 SASI_Mm01_00043960 predicted 1503
4 SASI_Mm01_00043961 predicted 403
5 SASI_Mm01_00043962 predicted 559
6 SASI_Mm01_00043964 predicted 374
7 SASI_Mm02_00327030 predicted 366
8 SASI_Mm01_00043965 predicted 459
9 SASI_Mm01_00043966 predicted 269
10 SASI_Mm01_00043967 predicted 726
11 SASI_Mm01_00043963 predicted 1167
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023292
VALIDATED
PUS3 MISSION shRNA Bacterial Glycerol Stock
pseudouridylate synthase 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000328318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023292.4-661s21c1
Sequence:CCGGTGAGCGGACTTATCGCTATTTCTCGAGAAATAGCGATAAGTCCGCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023292.4-504s21c1
Sequence:CCGGGCAGGGATTCAGAAGATTCTACTCGAGTAGAATCTTCTGAATCCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023292.4-374s21c1
Sequence:CCGGGCTTTAACTAAGACCCGACTACTCGAGTAGTCGGGTCTTAGTTAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328319    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023292.4-1739s21c1
Sequence:CCGGAGTCTGGTCTACAAGTATATTCTCGAGAATATACTTGTAGACCAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023292.4-1022s21c1
Sequence:CCGGCCTCAATATAGCATGGCTGTTCTCGAGAACAGCCATGCTATATTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120132    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023292.2-1563s1c1
Sequence:CCGGCCAGGGAGCAATAACCAGTTACTCGAGTAACTGGTTATTGCTCCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_023292.2-375s1c1
Sequence:CCGGGCTTTAACTAAGACCCGACTACTCGAGTAGTCGGGTCTTAGTTAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_023292.2-1023s1c1
Sequence:CCGGCCTCAATATAGCATGGCTGTTCTCGAGAACAGCCATGCTATATTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023292.2-1404s1c1
Sequence:CCGGCCACATTTACTCCATAAGGAACTCGAGTTCCTTATGGAGTAAATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_023292.2-505s1c1
Sequence:CCGGGCAGGGATTCAGAAGATTCTACTCGAGTAGAATCTTCTGAATCCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023292
VALIDATED
PUS3 MISSION shRNA shRNA Plasmid DNA
pseudouridylate synthase 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000328318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023292.4-661s21c1
Sequence:CCGGTGAGCGGACTTATCGCTATTTCTCGAGAAATAGCGATAAGTCCGCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023292.4-504s21c1
Sequence:CCGGGCAGGGATTCAGAAGATTCTACTCGAGTAGAATCTTCTGAATCCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023292.4-374s21c1
Sequence:CCGGGCTTTAACTAAGACCCGACTACTCGAGTAGTCGGGTCTTAGTTAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328319    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023292.4-1739s21c1
Sequence:CCGGAGTCTGGTCTACAAGTATATTCTCGAGAATATACTTGTAGACCAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023292.4-1022s21c1
Sequence:CCGGCCTCAATATAGCATGGCTGTTCTCGAGAACAGCCATGCTATATTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120132    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023292.2-1563s1c1
Sequence:CCGGCCAGGGAGCAATAACCAGTTACTCGAGTAACTGGTTATTGCTCCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_023292.2-375s1c1
Sequence:CCGGGCTTTAACTAAGACCCGACTACTCGAGTAGTCGGGTCTTAGTTAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_023292.2-1023s1c1
Sequence:CCGGCCTCAATATAGCATGGCTGTTCTCGAGAACAGCCATGCTATATTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023292.2-1404s1c1
Sequence:CCGGCCACATTTACTCCATAAGGAACTCGAGTTCCTTATGGAGTAAATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_023292.2-505s1c1
Sequence:CCGGGCAGGGATTCAGAAGATTCTACTCGAGTAGAATCTTCTGAATCCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023292
VALIDATED
PUS3 MISSION shRNA Lentiviral Transduction Particles
pseudouridylate synthase 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000328318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023292.4-661s21c1
Sequence:CCGGTGAGCGGACTTATCGCTATTTCTCGAGAAATAGCGATAAGTCCGCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023292.4-504s21c1
Sequence:CCGGGCAGGGATTCAGAAGATTCTACTCGAGTAGAATCTTCTGAATCCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023292.4-374s21c1
Sequence:CCGGGCTTTAACTAAGACCCGACTACTCGAGTAGTCGGGTCTTAGTTAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328319    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023292.4-1739s21c1
Sequence:CCGGAGTCTGGTCTACAAGTATATTCTCGAGAATATACTTGTAGACCAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023292.4-1022s21c1
Sequence:CCGGCCTCAATATAGCATGGCTGTTCTCGAGAACAGCCATGCTATATTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120132    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023292.2-1563s1c1
Sequence:CCGGCCAGGGAGCAATAACCAGTTACTCGAGTAACTGGTTATTGCTCCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_023292.2-375s1c1
Sequence:CCGGGCTTTAACTAAGACCCGACTACTCGAGTAGTCGGGTCTTAGTTAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_023292.2-1023s1c1
Sequence:CCGGCCTCAATATAGCATGGCTGTTCTCGAGAACAGCCATGCTATATTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023292.2-1404s1c1
Sequence:CCGGCCACATTTACTCCATAAGGAACTCGAGTTCCTTATGGAGTAAATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_023292.2-505s1c1
Sequence:CCGGGCAGGGATTCAGAAGATTCTACTCGAGTAGAATCTTCTGAATCCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031307
VALIDATED
PUS3 MISSION shRNA Bacterial Glycerol Stock
pseudouridylate synthase 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158099    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031307.2-114s1c1
Sequence:CCGGCCAGACTGAGAAGCTCCTAAACTCGAGTTTAGGAGCTTCTCAGTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_031307.2-1388s1c1
Sequence:CCGGGACGAATTGAGCACCCACATTCTCGAGAATGTGGGTGCTCAATTCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_031307.2-272s1c1
Sequence:CCGGGAAGACACGTAGCCCTAAGAACTCGAGTTCTTAGGGCTACGTGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157339    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_031307.2-1565s1c1
Sequence:CCGGCCTAATGGTAGGTGGACAGAACTCGAGTTCTGTCCACCTACCATTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_031307.2-547s1c1
Sequence:CCGGGCTGCTGAAGAGATCCGTTATCTCGAGATAACGGATCTCTTCAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_031307.2-373s1c1
Sequence:CCGGGCTCTAACCAAGACTCGACTACTCGAGTAGTCGAGTCTTGGTTAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031307.2-1128s1c1
Sequence:CCGGCCTACAACAACTGTGGGCTAACTCGAGTTAGCCCACAGTTGTTGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_031307.2-1390s1c1
Sequence:CCGGCGAATTGAGCACCCACATTTACTCGAGTAAATGTGGGTGCTCAATTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_031307.2-154s1c1
Sequence:CCGGCAAGAGGTGCAAAGACTTAAACTCGAGTTTAAGTCTTTGCACCTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031307.2-1534s1c1
Sequence:CCGGCCATAGACAATTTGCCAGGATCTCGAGATCCTGGCAAATTGTCTATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031307
VALIDATED
PUS3 MISSION shRNA shRNA Plasmid DNA
pseudouridylate synthase 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158099    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031307.2-114s1c1
Sequence:CCGGCCAGACTGAGAAGCTCCTAAACTCGAGTTTAGGAGCTTCTCAGTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_031307.2-1388s1c1
Sequence:CCGGGACGAATTGAGCACCCACATTCTCGAGAATGTGGGTGCTCAATTCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_031307.2-272s1c1
Sequence:CCGGGAAGACACGTAGCCCTAAGAACTCGAGTTCTTAGGGCTACGTGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157339    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_031307.2-1565s1c1
Sequence:CCGGCCTAATGGTAGGTGGACAGAACTCGAGTTCTGTCCACCTACCATTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_031307.2-547s1c1
Sequence:CCGGGCTGCTGAAGAGATCCGTTATCTCGAGATAACGGATCTCTTCAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_031307.2-373s1c1
Sequence:CCGGGCTCTAACCAAGACTCGACTACTCGAGTAGTCGAGTCTTGGTTAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031307.2-1128s1c1
Sequence:CCGGCCTACAACAACTGTGGGCTAACTCGAGTTAGCCCACAGTTGTTGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_031307.2-1390s1c1
Sequence:CCGGCGAATTGAGCACCCACATTTACTCGAGTAAATGTGGGTGCTCAATTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_031307.2-154s1c1
Sequence:CCGGCAAGAGGTGCAAAGACTTAAACTCGAGTTTAAGTCTTTGCACCTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031307.2-1534s1c1
Sequence:CCGGCCATAGACAATTTGCCAGGATCTCGAGATCCTGGCAAATTGTCTATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031307
VALIDATED
PUS3 MISSION shRNA Lentiviral Transduction Particles
pseudouridylate synthase 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158099    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031307.2-114s1c1
Sequence:CCGGCCAGACTGAGAAGCTCCTAAACTCGAGTTTAGGAGCTTCTCAGTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_031307.2-1388s1c1
Sequence:CCGGGACGAATTGAGCACCCACATTCTCGAGAATGTGGGTGCTCAATTCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_031307.2-272s1c1
Sequence:CCGGGAAGACACGTAGCCCTAAGAACTCGAGTTCTTAGGGCTACGTGTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157339    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_031307.2-1565s1c1
Sequence:CCGGCCTAATGGTAGGTGGACAGAACTCGAGTTCTGTCCACCTACCATTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_031307.2-547s1c1
Sequence:CCGGGCTGCTGAAGAGATCCGTTATCTCGAGATAACGGATCTCTTCAGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_031307.2-373s1c1
Sequence:CCGGGCTCTAACCAAGACTCGACTACTCGAGTAGTCGAGTCTTGGTTAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031307.2-1128s1c1
Sequence:CCGGCCTACAACAACTGTGGGCTAACTCGAGTTAGCCCACAGTTGTTGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_031307.2-1390s1c1
Sequence:CCGGCGAATTGAGCACCCACATTTACTCGAGTAAATGTGGGTGCTCAATTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_031307.2-154s1c1
Sequence:CCGGCAAGAGGTGCAAAGACTTAAACTCGAGTTTAAGTCTTTGCACCTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031307.2-1534s1c1
Sequence:CCGGCCATAGACAATTTGCCAGGATCTCGAGATCCTGGCAAATTGTCTATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)