EMAIL THIS PAGE TO A FRIEND

PUS7L

pseudouridylate synthase 7 homolog (S. cerevisiae)-like

118 Gene Product Result for
UniProtKB ID: Q9H0K6, Q05CU0, Q6AHZ3, Q6NUP2
Gene ID:
Mouse(78895) pseudouridylate synthase 7 homolog (S. cerevisiae)-like
Rat(315264) pseudouridylate synthase 7 homolog (S. cerevisiae)-like
Zebrafish(561376) pseudouridylate synthase 7 homolog (S. cerevisiae)-like
Horse(100054808) pseudouridylate synthase 7 homolog (S. cerevisiae)-like
dog(477637) pseudouridylate synthase 7 homolog (S. cerevisiae)-like
domestic cat(101081058) pseudouridylate synthase 7 homolog (S. cerevisiae)-like
chicken(417795) pseudouridylate synthase 7 homolog (S. cerevisiae)-like
cow(505464) pseudouridylate synthase 7 homolog (S. cerevisiae)-like
sheep(101115198) pseudouridylate synthase 7 homolog (S. cerevisiae)-like
naked mole-rat(101697809) pseudouridylate synthase 7 homolog (S. cerevisiae)-like
domestic guinea pig(100714789) pseudouridylate synthase 7 homolog (S. cerevisiae)-like
Gene Class: Dehydratase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172437 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172437 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172437 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031292 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031292 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031292 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098614 Rosetta Predictions human pricing
NM_001098615 Rosetta Predictions human pricing
NM_031292 Rosetta Predictions human pricing
XM_001058268 Rosetta Predictions rat pricing
XM_235612 Rosetta Predictions rat pricing
NM_172437 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098614 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319476 predicted 1935
2 SASI_Hs02_00319477 predicted 1471
3 SASI_Hs02_00319478 predicted 1778
4 SASI_Hs02_00319479 predicted 1693
5 SASI_Hs02_00319480 predicted 1696
6 SASI_Hs02_00319481 predicted 680
7 SASI_Hs02_00319482 predicted 1608
8 SASI_Hs02_00319483 predicted 1943
9 SASI_Hs02_00319484 predicted 332
10 SASI_Hs02_00319485 predicted 1700
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098615 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319486 predicted 2352
2 SASI_Hs02_00319487 predicted 1889
3 SASI_Hs02_00319488 predicted 2187
4 SASI_Hs02_00319489 predicted 2108
5 SASI_Hs02_00319490 predicted 2104
6 SASI_Hs02_00319491 predicted 1099
7 SASI_Hs02_00319492 predicted 2024
8 SASI_Hs02_00319493 predicted 2351
9 SASI_Hs02_00319494 predicted 749
10 SASI_Hs02_00319495 predicted 2111
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031292 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00358726 predicted 1946
2 SASI_Hs01_00163787 predicted 1473
3 SASI_Hs02_00358727 predicted 1774
4 SASI_Hs01_00163788 predicted 1703
5 SASI_Hs02_00358728 predicted 1701
6 SASI_Hs01_00163790 predicted 689
7 SASI_Hs01_00163791 predicted 1612
8 SASI_Hs01_00163793 predicted 1951
9 SASI_Hs01_00163794 predicted 336
10 SASI_Hs01_00163795 predicted 1710
11 SASI_Hs01_00163786 predicted 1475
12 SASI_Hs01_00163789 predicted 259
13 SASI_Hs01_00163792 predicted 772
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058268 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00289176 predicted 1054
2 SASI_Rn02_00289177 predicted 370
3 SASI_Rn02_00289178 predicted 1123
4 SASI_Rn02_00289179 predicted 471
5 SASI_Rn02_00289180 predicted 1458
6 SASI_Rn02_00289181 predicted 569
7 SASI_Rn02_00289182 predicted 1615
8 SASI_Rn02_00289183 predicted 987
9 SASI_Rn02_00289184 predicted 922
10 SASI_Rn02_00289185 predicted 840
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235612 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00187703 predicted 2039
2 SASI_Rn01_00187704 predicted 1177
3 SASI_Rn01_00187705 predicted 1179
4 SASI_Rn01_00187706 predicted 1487
5 SASI_Rn01_00187707 predicted 699
6 SASI_Rn01_00187708 predicted 1229
7 SASI_Rn01_00187709 predicted 1649
8 SASI_Rn01_00187710 predicted 1109
9 SASI_Rn01_00187711 predicted 1053
10 SASI_Rn01_00187712 predicted 963
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172437 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00063065 predicted 1146
2 SASI_Mm01_00063066 predicted 1009
3 SASI_Mm01_00063067 predicted 1466
4 SASI_Mm01_00063068 predicted 392
5 SASI_Mm01_00063069 predicted 1004
6 SASI_Mm01_00063070 predicted 2123
7 SASI_Mm01_00063072 predicted 990
8 SASI_Mm01_00063073 predicted 1797
9 SASI_Mm01_00063074 predicted 1069
10 SASI_Mm02_00343926 predicted 1450
11 SASI_Mm01_00063071 predicted 487
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172437
VALIDATED
PUS7L MISSION shRNA Bacterial Glycerol Stock
pseudouridylate synthase 7 homolog (S. cerevisiae)-like
Mouse
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000443135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172437.3-2159s21c1
Sequence:CCGGGCGACATTTAAGCTCACACACCTCGAGGTGTGTGAGCTTAAATGTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172437.3-1749s21c1
Sequence:CCGGTGAAGATGCGGACAAGCATTTCTCGAGAAATGCTTGTCCGCATCTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416575    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172437.3-2586s21c1
Sequence:CCGGGTATTTATGAGATACTGAAGACTCGAGTCTTCAGTATCTCATAAATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172437.1-1442s1c1
Sequence:CCGGCGTGGATGATCCTGTCAATAACTCGAGTTATTGACAGGATCATCCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182449    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172437.1-2332s1c1
Sequence:CCGGGTGCTCTCTAAGGTCATGCTTCTCGAGAAGCATGACCTTAGAGAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172437.1-612s1c1
Sequence:CCGGGTAGGAAACCAGGGTGAAGTTCTCGAGAACTTCACCCTGGTTTCCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172437.2-247s1c1
Sequence:CCGGCAAGAAGCCAAAGTTAAATATCTCGAGATATTTAACTTTGGCTTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172437.2-1007s1c1
Sequence:CCGGGCCGTCAAACTTGGTGTTATTCTCGAGAATAACACCAAGTTTGACGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172437.3-1770s21c1
Sequence:CCTGCCCAAGCAGTAAAGTTCATCTCTCGAGAGATGAACTTTACTGCTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172437.3-1655s21c1
Sequence:CCGGACGCATACAGTAGCAGGATTTCTCGAGAAATCCTGCTACTGTATGCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178334    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172437.1-2299s1c1
Sequence:CCGGGCACCGGTGTCTTAAGTTTAACTCGAGTTAAACTTAAGACACCGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172437.1-1548s1c1
Sequence:CCGGCTGGAGTCATTGCATCGCTTTCTCGAGAAAGCGATGCAATGACTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415567    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172437.3-2566s21c1
Sequence:CCGGGCAGTATCTGTTCTCATAATGCTCGAGCATTATGAGAACAGATACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172437.3-1677s21c1
Sequence:CCGGGAACGAGGCAGCATCTTACAGCTCGAGCTGTAAGATGCTGCCTCGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172437.2-1147s1c1
Sequence:CCGGGAGAATGAATGTGTTCAATATCTCGAGATATTGAACACATTCATTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172437.1-384s1c1
Sequence:CCGGGTGACTTCTAAATGTGAAGAACTCGAGTTCTTCACATTTAGAAGTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429599    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172437.3-2490s21c1
Sequence:CCGGATGGCGAAACCTCGGTGCTTTCTCGAGAAAGCACCGAGGTTTCGCCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428999    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172437.3-2295s21c1
Sequence:CCGGGGTGTGATGTATTAACGTAAGCTCGAGCTTACGTTAATACATCACACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172437
VALIDATED
PUS7L MISSION shRNA shRNA Plasmid DNA
pseudouridylate synthase 7 homolog (S. cerevisiae)-like
Mouse
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000443135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172437.3-2159s21c1
Sequence:CCGGGCGACATTTAAGCTCACACACCTCGAGGTGTGTGAGCTTAAATGTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172437.3-1749s21c1
Sequence:CCGGTGAAGATGCGGACAAGCATTTCTCGAGAAATGCTTGTCCGCATCTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416575    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172437.3-2586s21c1
Sequence:CCGGGTATTTATGAGATACTGAAGACTCGAGTCTTCAGTATCTCATAAATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172437.1-1442s1c1
Sequence:CCGGCGTGGATGATCCTGTCAATAACTCGAGTTATTGACAGGATCATCCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182449    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172437.1-2332s1c1
Sequence:CCGGGTGCTCTCTAAGGTCATGCTTCTCGAGAAGCATGACCTTAGAGAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172437.1-612s1c1
Sequence:CCGGGTAGGAAACCAGGGTGAAGTTCTCGAGAACTTCACCCTGGTTTCCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172437.2-247s1c1
Sequence:CCGGCAAGAAGCCAAAGTTAAATATCTCGAGATATTTAACTTTGGCTTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172437.2-1007s1c1
Sequence:CCGGGCCGTCAAACTTGGTGTTATTCTCGAGAATAACACCAAGTTTGACGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172437.3-1770s21c1
Sequence:CCTGCCCAAGCAGTAAAGTTCATCTCTCGAGAGATGAACTTTACTGCTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172437.3-1655s21c1
Sequence:CCGGACGCATACAGTAGCAGGATTTCTCGAGAAATCCTGCTACTGTATGCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178334    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172437.1-2299s1c1
Sequence:CCGGGCACCGGTGTCTTAAGTTTAACTCGAGTTAAACTTAAGACACCGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172437.1-1548s1c1
Sequence:CCGGCTGGAGTCATTGCATCGCTTTCTCGAGAAAGCGATGCAATGACTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415567    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172437.3-2566s21c1
Sequence:CCGGGCAGTATCTGTTCTCATAATGCTCGAGCATTATGAGAACAGATACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172437.3-1677s21c1
Sequence:CCGGGAACGAGGCAGCATCTTACAGCTCGAGCTGTAAGATGCTGCCTCGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172437.2-1147s1c1
Sequence:CCGGGAGAATGAATGTGTTCAATATCTCGAGATATTGAACACATTCATTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172437.1-384s1c1
Sequence:CCGGGTGACTTCTAAATGTGAAGAACTCGAGTTCTTCACATTTAGAAGTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429599    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172437.3-2490s21c1
Sequence:CCGGATGGCGAAACCTCGGTGCTTTCTCGAGAAAGCACCGAGGTTTCGCCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428999    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172437.3-2295s21c1
Sequence:CCGGGGTGTGATGTATTAACGTAAGCTCGAGCTTACGTTAATACATCACACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172437
VALIDATED
PUS7L MISSION shRNA Lentiviral Transduction Particles
pseudouridylate synthase 7 homolog (S. cerevisiae)-like
Mouse
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000443135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172437.3-2159s21c1
Sequence:CCGGGCGACATTTAAGCTCACACACCTCGAGGTGTGTGAGCTTAAATGTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172437.3-1749s21c1
Sequence:CCGGTGAAGATGCGGACAAGCATTTCTCGAGAAATGCTTGTCCGCATCTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416575    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172437.3-2586s21c1
Sequence:CCGGGTATTTATGAGATACTGAAGACTCGAGTCTTCAGTATCTCATAAATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172437.1-1442s1c1
Sequence:CCGGCGTGGATGATCCTGTCAATAACTCGAGTTATTGACAGGATCATCCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182449    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172437.1-2332s1c1
Sequence:CCGGGTGCTCTCTAAGGTCATGCTTCTCGAGAAGCATGACCTTAGAGAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172437.1-612s1c1
Sequence:CCGGGTAGGAAACCAGGGTGAAGTTCTCGAGAACTTCACCCTGGTTTCCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172437.2-247s1c1
Sequence:CCGGCAAGAAGCCAAAGTTAAATATCTCGAGATATTTAACTTTGGCTTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172437.2-1007s1c1
Sequence:CCGGGCCGTCAAACTTGGTGTTATTCTCGAGAATAACACCAAGTTTGACGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172437.3-1770s21c1
Sequence:CCTGCCCAAGCAGTAAAGTTCATCTCTCGAGAGATGAACTTTACTGCTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172437.3-1655s21c1
Sequence:CCGGACGCATACAGTAGCAGGATTTCTCGAGAAATCCTGCTACTGTATGCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178334    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172437.1-2299s1c1
Sequence:CCGGGCACCGGTGTCTTAAGTTTAACTCGAGTTAAACTTAAGACACCGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172437.1-1548s1c1
Sequence:CCGGCTGGAGTCATTGCATCGCTTTCTCGAGAAAGCGATGCAATGACTCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415567    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172437.3-2566s21c1
Sequence:CCGGGCAGTATCTGTTCTCATAATGCTCGAGCATTATGAGAACAGATACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172437.3-1677s21c1
Sequence:CCGGGAACGAGGCAGCATCTTACAGCTCGAGCTGTAAGATGCTGCCTCGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172437.2-1147s1c1
Sequence:CCGGGAGAATGAATGTGTTCAATATCTCGAGATATTGAACACATTCATTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172437.1-384s1c1
Sequence:CCGGGTGACTTCTAAATGTGAAGAACTCGAGTTCTTCACATTTAGAAGTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429599    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172437.3-2490s21c1
Sequence:CCGGATGGCGAAACCTCGGTGCTTTCTCGAGAAAGCACCGAGGTTTCGCCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428999    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172437.3-2295s21c1
Sequence:CCGGGGTGTGATGTATTAACGTAAGCTCGAGCTTACGTTAATACATCACACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031292
PUS7L MISSION shRNA Bacterial Glycerol Stock
pseudouridylate synthase 7 homolog (S. cerevisiae)-like
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031292.2-133s1c1
Sequence:CCGGCGTTGGATTTCATGGCACTATCTCGAGATAGTGCCATGAAATCCAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143611    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031292.2-3776s1c1
Sequence:CCGGGCCTGGCACTTAGTTATTGTTCTCGAGAACAATAACTAAGTGCCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031292.2-1007s1c1
Sequence:CCGGCTGGAAATGTTTGAAGCGATTCTCGAGAATCGCTTCAAACATTTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031292.2-1533s1c1
Sequence:CCGGCACTTTCATTGATGCCTGAATCTCGAGATTCAGGCATCAATGAAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031292.2-2142s1c1
Sequence:CCGGCCGTTTGTCTGAAGGAAATAACTCGAGTTATTTCCTTCAGACAAACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031292.2-246s1c1
Sequence:CCGGGTGAAATACAACTTGAGCCAACTCGAGTTGGCTCAAGTTGTATTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031292.2-1961s1c1
Sequence:CCGGGTACCTACTCTGAAACTGAATCTCGAGATTCAGTTTCAGAGTAGGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031292.2-1006s1c1
Sequence:CCGGCCTGGAAATGTTTGAAGCGATCTCGAGATCGCTTCAAACATTTCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031292.2-1697s1c1
Sequence:CCGGGCAGTATCTTACAGACTTGAACTCGAGTTCAAGTCTGTAAGATACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031292.2-591s1c1
Sequence:CCGGCTAGTTTACACAGTGCCATTACTCGAGTAATGGCACTGTGTAAACTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122092    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031292.2-3777s1c1
Sequence:CCGGCCTGGCACTTAGTTATTGTTACTCGAGTAACAATAACTAAGTGCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121558    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031292.2-2699s1c1
Sequence:CCGGCCAGAGTAGTTATTACCTCTTCTCGAGAAGAGGTAATAACTACTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031292
PUS7L MISSION shRNA shRNA Plasmid DNA
pseudouridylate synthase 7 homolog (S. cerevisiae)-like
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031292.2-133s1c1
Sequence:CCGGCGTTGGATTTCATGGCACTATCTCGAGATAGTGCCATGAAATCCAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143611    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031292.2-3776s1c1
Sequence:CCGGGCCTGGCACTTAGTTATTGTTCTCGAGAACAATAACTAAGTGCCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031292.2-1007s1c1
Sequence:CCGGCTGGAAATGTTTGAAGCGATTCTCGAGAATCGCTTCAAACATTTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031292.2-1533s1c1
Sequence:CCGGCACTTTCATTGATGCCTGAATCTCGAGATTCAGGCATCAATGAAAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031292.2-2142s1c1
Sequence:CCGGCCGTTTGTCTGAAGGAAATAACTCGAGTTATTTCCTTCAGACAAACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031292.2-246s1c1
Sequence:CCGGGTGAAATACAACTTGAGCCAACTCGAGTTGGCTCAAGTTGTATTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031292.2-1961s1c1
Sequence:CCGGGTACCTACTCTGAAACTGAATCTCGAGATTCAGTTTCAGAGTAGGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031292.2-1006s1c1
Sequence:CCGGCCTGGAAATGTTTGAAGCGATCTCGAGATCGCTTCAAACATTTCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031292.2-1697s1c1
Sequence:CCGGGCAGTATCTTACAGACTTGAACTCGAGTTCAAGTCTGTAAGATACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031292.2-591s1c1
Sequence:CCGGCTAGTTTACACAGTGCCATTACTCGAGTAATGGCACTGTGTAAACTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122092    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031292.2-3777s1c1
Sequence:CCGGCCTGGCACTTAGTTATTGTTACTCGAGTAACAATAACTAAGTGCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121558    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031292.2-2699s1c1
Sequence:CCGGCCAGAGTAGTTATTACCTCTTCTCGAGAAGAGGTAATAACTACTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031292
PUS7L MISSION shRNA Lentiviral Transduction Particles
pseudouridylate synthase 7 homolog (S. cerevisiae)-like
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031292.2-133s1c1
Sequence:CCGGCGTTGGATTTCATGGCACTATCTCGAGATAGTGCCATGAAATCCAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143611    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031292.2-3776s1c1
Sequence:CCGGGCCTGGCACTTAGTTATTGTTCTCGAGAACAATAACTAAGTGCCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031292.2-1007s1c1
Sequence:CCGGCTGGAAATGTTTGAAGCGATTCTCGAGAATCGCTTCAAACATTTCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031292.2-1533s1c1
Sequence:CCGGCACTTTCATTGATGCCTGAATCTCGAGATTCAGGCATCAATGAAAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031292.2-2142s1c1
Sequence:CCGGCCGTTTGTCTGAAGGAAATAACTCGAGTTATTTCCTTCAGACAAACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031292.2-246s1c1
Sequence:CCGGGTGAAATACAACTTGAGCCAACTCGAGTTGGCTCAAGTTGTATTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031292.2-1961s1c1
Sequence:CCGGGTACCTACTCTGAAACTGAATCTCGAGATTCAGTTTCAGAGTAGGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031292.2-1006s1c1
Sequence:CCGGCCTGGAAATGTTTGAAGCGATCTCGAGATCGCTTCAAACATTTCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031292.2-1697s1c1
Sequence:CCGGGCAGTATCTTACAGACTTGAACTCGAGTTCAAGTCTGTAAGATACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031292.2-591s1c1
Sequence:CCGGCTAGTTTACACAGTGCCATTACTCGAGTAATGGCACTGTGTAAACTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122092    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031292.2-3777s1c1
Sequence:CCGGCCTGGCACTTAGTTATTGTTACTCGAGTAACAATAACTAAGTGCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121558    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031292.2-2699s1c1
Sequence:CCGGCCAGAGTAGTTATTACCTCTTCTCGAGAAGAGGTAATAACTACTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)