EMAIL THIS PAGE TO A FRIEND

PVALB

parvalbumin

81 Gene Product Result for
Synonyms: D22S749
UniProtKB ID: P20472, B2R4H7, P78378, Q4VB78, Q5R3Q9
Gene ID:
Human(5816) Summary: The protein encoded by this gene is a high affinity calcium ion-binding protein that is structurally and functionally similar to calmodulin and troponin C. The encoded protein is thought to be involved in muscle relaxation. [provided by RefSeq, Jul 2008]
Mouse(19293) parvalbumin
Rat(25269) parvalbumin
chicken(396459) parvalbumin
Horse(100069554) parvalbumin
dog(481278) parvalbumin
cow(538603) parvalbumin
sheep(101122682) parvalbumin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
E8406 Anti-EDEM1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
immunoprecipitation (IP), western blot pricing
SAB2500752 Anti-Parvalbumin antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, human
ELISA, flow cytometry, immunohistochemistry, western blot pricing
HPA048536 Anti-PVALB antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry, western blot pricing
P3088 Monoclonal Anti-Parvalbumin antibody produced in mouse clone PARV-19, ascites fluid feline, human, bovine, rat, frog, fish, goat, canine, pig, rabbit
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013645 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013645 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013645 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002854 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002854 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002854 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002854 Rosetta Predictions human pricing
NM_022499 Rosetta Predictions rat pricing
NM_013645 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002854 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228383 predicted 234
2 SASI_Hs01_00228384 predicted 231
3 SASI_Hs01_00228382 predicted 267
4 SASI_Hs02_00334600 predicted 231
5 SASI_Hs02_00334601 predicted 225
6 SASI_Hs01_00228385 predicted 264
7 SASI_Hs01_00228386 predicted 298
8 SASI_Hs01_00228387 predicted 272
9 SASI_Hs02_00334602 predicted 211
10 SASI_Hs02_00334603 predicted 226
11 SASI_Hs01_00228388 predicted 280
12 SASI_Hs01_00228389 predicted 276
13 SASI_Hs01_00228390 predicted 229
14 SASI_Hs01_00228391 predicted 281
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022499 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00263187 predicted 233
2 SASI_Rn02_00263188 predicted 258
3 SASI_Rn02_00263189 predicted 260
4 SASI_Rn02_00263190 predicted 230
5 SASI_Rn02_00263191 predicted 215
6 SASI_Rn02_00263192 predicted 268
7 SASI_Rn02_00263193 predicted 264
8 SASI_Rn02_00263194 predicted 258
9 SASI_Rn02_00263195 predicted 234
10 SASI_Rn02_00263196 predicted 241
11 SASI_Rn01_00047350 predicted 625
12 SASI_Rn01_00047351 predicted 684
13 SASI_Rn01_00047352 predicted 491
14 SASI_Rn01_00047353 predicted 485
15 SASI_Rn01_00047354 predicted 616
16 SASI_Rn01_00047355 predicted 235
17 SASI_Rn01_00047356 predicted 537
18 SASI_Rn01_00047357 predicted 487
19 SASI_Rn01_00047358 predicted 417
20 SASI_Rn01_00047359 predicted 518
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013645 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322446 predicted 239
2 SASI_Mm01_00084195 predicted 269
3 SASI_Mm01_00084197 predicted 327
4 SASI_Mm01_00084198 predicted 267
5 SASI_Mm01_00084200 predicted 247
6 SASI_Mm01_00084201 predicted 350
7 SASI_Mm01_00084203 predicted 217
8 SASI_Mm02_00322447 predicted 271
9 SASI_Mm02_00322448 predicted 329
10 SASI_Mm02_00322449 predicted 244
11 SASI_Mm01_00084196 predicted 331
12 SASI_Mm01_00084199 predicted 337
13 SASI_Mm01_00084202 predicted 258
14 SASI_Mm01_00084204 predicted 341
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013645
PVALB MISSION shRNA Bacterial Glycerol Stock
parvalbumin
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436670    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013645.3-720s21c1
Sequence:CCGGGCACCTTTCCCACAAGGAGATCTCGAGATCTCCTTGTGGGAAAGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013645.3-138s21c1
Sequence:CCGGAGAACCCGGATGAGGTGAAGACTCGAGTCTTCACCTCATCCGGGTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419254    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013645.3-533s21c1
Sequence:CCGGACCAATCGGACACCACCTGTACTCGAGTACAGGTGGTGTCCGATTGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013645.2-86s1c1
Sequence:CCGGGCAGACTCCTTCGACCACAAACTCGAGTTTGTGGTCGAAGGAGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013645.3-676s21c1
Sequence:CCGGTGCTTGGTACTGAGTGCTCATCTCGAGATGAGCACTCAGTACCAAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104820    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013645.2-435s1c1
Sequence:CCGGCTGTTCAGTTTGTTTGTGTTACTCGAGTAACACAAACAAACTGAACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013645.2-161s1c1
Sequence:CCGGGTGTTCCATATTCTGGACAAACTCGAGTTTGTCCAGAATATGGAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013645.2-53s1c1
Sequence:CCGGGACATCAAGAAGGCGATAGGACTCGAGTCCTATCGCCTTCTTGATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013645.2-253s1c1
Sequence:CCGGCTTGTCTGCTAAAGAAACAAACTCGAGTTTGTTTCTTTAGCAGACAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013645
PVALB MISSION shRNA shRNA Plasmid DNA
parvalbumin
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436670    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013645.3-720s21c1
Sequence:CCGGGCACCTTTCCCACAAGGAGATCTCGAGATCTCCTTGTGGGAAAGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013645.3-138s21c1
Sequence:CCGGAGAACCCGGATGAGGTGAAGACTCGAGTCTTCACCTCATCCGGGTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419254    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013645.3-533s21c1
Sequence:CCGGACCAATCGGACACCACCTGTACTCGAGTACAGGTGGTGTCCGATTGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013645.2-86s1c1
Sequence:CCGGGCAGACTCCTTCGACCACAAACTCGAGTTTGTGGTCGAAGGAGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000447469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013645.3-676s21c1
Sequence:CCGGTGCTTGGTACTGAGTGCTCATCTCGAGATGAGCACTCAGTACCAAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104820    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013645.2-435s1c1
Sequence:CCGGCTGTTCAGTTTGTTTGTGTTACTCGAGTAACACAAACAAACTGAACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013645.2-161s1c1
Sequence:CCGGGTGTTCCATATTCTGGACAAACTCGAGTTTGTCCAGAATATGGAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013645.2-53s1c1
Sequence:CCGGGACATCAAGAAGGCGATAGGACTCGAGTCCTATCGCCTTCTTGATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013645.2-253s1c1
Sequence:CCGGCTTGTCTGCTAAAGAAACAAACTCGAGTTTGTTTCTTTAGCAGACAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013645
PVALB MISSION shRNA Lentiviral Transduction Particles
parvalbumin
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436670    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013645.3-720s21c1
Sequence:CCGGGCACCTTTCCCACAAGGAGATCTCGAGATCTCCTTGTGGGAAAGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013645.3-138s21c1
Sequence:CCGGAGAACCCGGATGAGGTGAAGACTCGAGTCTTCACCTCATCCGGGTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419254    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013645.3-533s21c1
Sequence:CCGGACCAATCGGACACCACCTGTACTCGAGTACAGGTGGTGTCCGATTGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013645.2-86s1c1
Sequence:CCGGGCAGACTCCTTCGACCACAAACTCGAGTTTGTGGTCGAAGGAGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013645.3-676s21c1
Sequence:CCGGTGCTTGGTACTGAGTGCTCATCTCGAGATGAGCACTCAGTACCAAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104820    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013645.2-435s1c1
Sequence:CCGGCTGTTCAGTTTGTTTGTGTTACTCGAGTAACACAAACAAACTGAACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013645.2-161s1c1
Sequence:CCGGGTGTTCCATATTCTGGACAAACTCGAGTTTGTCCAGAATATGGAACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013645.2-53s1c1
Sequence:CCGGGACATCAAGAAGGCGATAGGACTCGAGTCCTATCGCCTTCTTGATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013645.2-253s1c1
Sequence:CCGGCTTGTCTGCTAAAGAAACAAACTCGAGTTTGTTTCTTTAGCAGACAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002854
PVALB MISSION shRNA Bacterial Glycerol Stock
parvalbumin
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002854.1-173s1c1
Sequence:CCGGGAGTGCGGATGATGTGAAGAACTCGAGTTCTTCACATCATCCGCACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002854.1-110s1c1
Sequence:CCGGCTTTAGCGCTACCGACTCCTTCTCGAGAAGGAGTCGGTAGCGCTAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002854.1-146s1c1
Sequence:CCGGCTTCCAAATGGTCGGCCTGAACTCGAGTTCAGGCCGACCATTTGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002854.1-191s1c1
Sequence:CCGGGAAGGTGTTTCACATGCTGGACTCGAGTCCAGCATGTGAAACACCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002854.1-242s1c1
Sequence:CCGGTGAGCTGGGATTCATCCTAAACTCGAGTTTAGGATGAATCCCAGCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002854
PVALB MISSION shRNA shRNA Plasmid DNA
parvalbumin
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002854.1-173s1c1
Sequence:CCGGGAGTGCGGATGATGTGAAGAACTCGAGTTCTTCACATCATCCGCACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002854.1-110s1c1
Sequence:CCGGCTTTAGCGCTACCGACTCCTTCTCGAGAAGGAGTCGGTAGCGCTAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002854.1-146s1c1
Sequence:CCGGCTTCCAAATGGTCGGCCTGAACTCGAGTTCAGGCCGACCATTTGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002854.1-191s1c1
Sequence:CCGGGAAGGTGTTTCACATGCTGGACTCGAGTCCAGCATGTGAAACACCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002854.1-242s1c1
Sequence:CCGGTGAGCTGGGATTCATCCTAAACTCGAGTTTAGGATGAATCCCAGCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002854
PVALB MISSION shRNA Lentiviral Transduction Particles
parvalbumin
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002854.1-173s1c1
Sequence:CCGGGAGTGCGGATGATGTGAAGAACTCGAGTTCTTCACATCATCCGCACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002854.1-110s1c1
Sequence:CCGGCTTTAGCGCTACCGACTCCTTCTCGAGAAGGAGTCGGTAGCGCTAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002854.1-146s1c1
Sequence:CCGGCTTCCAAATGGTCGGCCTGAACTCGAGTTCAGGCCGACCATTTGGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002854.1-191s1c1
Sequence:CCGGGAAGGTGTTTCACATGCTGGACTCGAGTCCAGCATGTGAAACACCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002854.1-242s1c1
Sequence:CCGGTGAGCTGGGATTCATCCTAAACTCGAGTTTAGGATGAATCCCAGCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)